From 2013.igem.org

(Difference between revisions)

Revision as of 08:00, 2 October 2013

Del H. This bitchy 18 kbp fragment.

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.

Week 1

In order to transfer the gold precipitating NRPS from D. acidovorans to E.coli, the necessary modules will be amplified from the D. acidovorans genome and assembled as plasmids. Due to its large size of 18 Kb, the module DelH will be expressed on a separate plasmid. A strategy was developed, primers designed accordingly and necessary BioBricks obtained from the distribution. The D. acidovorans was obtained from the DSMZ and cultured in Acidovorax complex medium.

Week 2

Using the designed primers DelH_f1_PacI_fw and DelH_f1_SalI_rev, the first PCRs to amplify DelH F1 as well as DelH_f2_SalI_fw and DelH_f2_KpnI_rev to amplify DelH F2 were performed and conditions optimized. Additionally, necessary backbone fragments pSB6A1 and lacZ were restriction digested. New BioBricks to obtain the AraC promotor (I13453 and K206000) were chosen.

Week 3

Since the reverse backbone primer DN08:AraCbb_PacI_rev did not work, a new one (DN06:AraCbb_PacI_rev2) was ordered, together with the colony PCR screening primer DN07:Screen_DelH_rev and DN13:Screen_DelH_fw to check for correct ligation of the DelH fragment F1.

Week 4

The elongation of the pSB6A1-AraC-lacZ backbone urned out to be troublesome. So in week 4, we performed different restriction digests with our final backbone pSB6A1-AraC-lacZ as well as with the former construct pSB1C3-AraC-lacZ to ensure identity of the backbone. Besides, the amplification of the DelH fragment F1 was planned: It is amplified divided in 2 subfragments - fragment F1a and fragment F1b. Each one of the fragments has the size of 5 Kb.

Week 5

In this week, we started all over again to assemble the backbone pSB6A1-AraC-lacZ: digesting AraC, lacZ and PSB6A1 based on the precedently amplified fragments. The amplification of DelH was continued and we succesfully amplified all 3 fragments and gel extracted them.

Week 6

Because we amplified all DelH-fragments needed and assembled the backbone in week 5, this week, we assembled the final plasmid pHM01. Therefore, every fragment was digested with two distinct enzymes, and then ligated. The ligated plasmid pHM01 was purified and electroporated in two separate DH10ß aliquots. Unfortunately, the screening via colony-PCR was negative, so none of the transformed E.coli successfully received the plasmid.

Week 7

In week 7, we reamplified the DelH fragments used for the transformation in week 6. We found out that amplification of fragments F1a and F1b was not reproducible. As conclusion, we designed new primers for DelH, which are capable to amplify the beginning of DelH in a more efficient and specific manner. The overview summarizes the primers we ordered and their performance in amplificating DelH F1a. Primer DN11 worked really well and is used in the next experiments.

Week 8

After improving the amplification of the beginning of DelH (fragment 1a with the primer DN11), we used a higher concentration in the ligation assembling the pHM01 plasmid. The transformation of DH10ß cells was performed with electroporation. Four colonies were positive in the screening-PCR, but did not express lacZ (no blue color). To quantify if DelH is possibly expressed anyhow, we plan a SDS-PAGE and induce the bacteria with higher concentrations of arabinose and X-Gal.

Week 9

The SDS-PAGE showed no clear band at ~600 kDa, so we conclude that there is most probably no DelH expression in the analyzed colonies. To confirm the result, a restriction digest was performed. The colonies did not show the expected pattern, so they indeed did not contain the desired plasmid. To perform a new assembly of the plasmid pHM01, the fragments of DelH and the backbone had to be reamplified. The amplifications of the DelH fragments went well, but the backbone caused again some difficulties and it was not possible to amplify it.

Week 10

When rechecking all amplified fragments, we did not find what we expected. On the one hand, the concentrations of the fragments were too low and could not be seen on the gel. On the other hand, a re-amplification of the fragments with the appropriate primers was not successful. Additionally, a new polymerase (Phusion Flash) was used. Interestingly for the DelH 1b fragment, the fragment amplified from the genomic DNA was slightly larger than the amplified fragments from itself.

Week 11

Based on this week's experiments and in silico analysis to validate the fragments DelH F1a, F1b and F2, we discarded the restriction digest and ligation strategy for the assembly of the DelH plasmid. Instead, we chose Gibson assembly as alternative method, developed a strategy and designed primers accordingly. We are positive, to finally assemble pHM02.

Week 12

The primers arrived and we started amplifying the Gibson fragments using different approaches. Since G1 could not be PCR amplified, we decided to divide G1 into sub fragments G1a and G1b, for which we had designed and ordered primers already. The amplification of fragment G2 worked well and was produced in reasonable amounts. Alternatively, we also produced the entire DelH as one fragment G0, as well as further sub fragments DelH G1/2a, G1b/2 and G2b. Amplification of G1b/2a did not work out. Due to the failure of the restriction digest strategy, we further analyzed the backbone pSB6A1-AraC-lacZ, which we decided to discard and instead, use pSB6A1 and BBa_J04450, which is already available in the parts registry.

Week 13

In order to realize the new strategy using the already existing backbone from the parts registry pSB6A1-lacZ-mRFP, we designed two new primers for the backbone amplification and created a map of pHM03. The plasmid for the backbone was obtained from the registry, transformed in E.coli and minipreped. The Gibson fragment of the backbone was successfully amplified, together with Gibson fragments DelH G0, G1 and G2b.

Week 14

In week 14, we've tested numerous colonies from last week's Gibson assembly 28-07 using DelH G0 as well as G1/2a and 2b by screening-PCR. None of the analyzed colonies carried a correct plasmid. We therefore performed another Gibson assembly 01-08 and again screened numerous clones. We found few possibly correct ones that will be further analyzed next week. Additionally, the new D. acidovorans strain SPH1, whose sequence is available in GenBank, was ordered. We will have to amplify all fragments from this strain again as soon as it arrives.

Week 15

We further tested colonies from last weeks Gibson assemblies using DelH G0 as well as G1/2a and 2b. Unfortunately, they were all negative in the screening-PCR. Therefore, we amplified our Gibson fragments again and performed more Gibson assemblies. Yet again, there were no positive colonies in the colony-PCR.

Week 16

We further characterized the DelH plasmid created using Gibson assembly. Unfortunately, none of the screened colonies was for sure positive. Selection of red colonies was not clear, and PCR screened colonies were all negative. In order to avoid high background during screening of the colonies, we decided to run two different strategies. For first approach pHM04, we will amplify the backbone without mRFP, avoiding backbone reassembly due to ribosome binding site homology. In the second strategy pHM05, we will additionally introduce a tetracycline resistance, to ensure integration of the insert. In addition to the primers for the new strategies, we designed a new screening primer at the end of DelH.

Week 17

After performing different Gibson assemblies and screening always resulted in negative clones, the possible explanation could be a religation of the backbone fragment pSB6A1 allowing E.coli to survive and express mRFP. This week, our aim is to design a new construct without mRFP, so that we can exclude the red colonies from the screening. Therefore, we are going to use a new reverse primer for the backbone including only the terminator of the mRFP, but not the mRFP. The primers for the backbone are HM11 & HM17. The construct is named pHM04 and further explained in week 16.

Week 18

Because the constructing pHM04 did not result in any positive clone (see experiments week 17), we will follow the idea to introduce a tetracycline resistance to the ampicillin backbone as additional selection marker for successful assembly. So we have to screen only colonies, which are white (because of the exclusion of mRFP) and grow on plates containing tetracycline. Furthermore, we decided to amplify DelH in various fragments to increase Gibson assembly efficiency. Therefore, we also ordered new screening primers. The primers were designed as shown in the following table.

Week 19

After a successful electroporation, we screen numerous clones by colony-PCR and test restriction digest (PvuI-HF). Positive clones are send for sequencing. The sequencing tells us if the DelH Gibson assembly actually worked. Therefore, we send the midipreped plasmids with the reverse DN07 primer or VF2, covering the start sequence of DelH and the end of the pSB6A1 backbone without mRFP (pHM04). The screening-PCR showed different positive colonies. After performing the restriction digest, some colonies were discarded and the rest was sent in for sequencing. We did not find any positive clone without a truncating mutation at the beginning of DelH (in the primer region).

Week 20

Again, the screening-PCRs resulted in many positive colonies. After the restriction digest, many colonies were kicked out. The remaining minipreped colonies were sent in for sequencing. Yet, we did not identify any positive clone which had no mutation at the beginning of DelH (in the primer region).

Week 21

Frustratingly, none of the analyzed clones showed a correct sequence. Probably, DelH by itself is toxic for E.coli and thus, only aberrant clones survive. We suspect the low quality of primers as reason for high number of mutations. Therefore, we will order HPLC purified primers. Additionally, we tried to eliminate the mutations in DelH clones I 6b and 15 by mutagenesis. Herefore, primers were ordered.

Week 22

So far, we failed to find a single correct DelH clone. We suspect the separate DelH module to be toxic for the E. coli. Therefore, they select for mutated plasmids. In order to reduce the selection pressure, we used E. coli BL21 DE3, known for increased expression of the lac repressor. This strategy also did not result in any correct clone. One reason might be, that the E. coli BL21 DE3 we obtained actually are BL21 DE3 pLys, which are unfortunately Chloramphenicol resistant due to additional plasmid and thus not useful for screening and amplification of DelH construct. We got new and correct E. coli BL21 DE3 as well as NEB turbo, which significantly overexpress the lac repressor. We however found their lacZ-controlled expression to be very leaky, in contrast to E. coli BL21 DE3. Since the Gibson assembly of DelH using the HPLC purified primers also exclusively resulted in mutated clones, we developed two new cloning strategies to avoid expression of DelH. The first strategy uses a weak promoter and RBS, the second introduces DelH in a ccdB helper construct. Last but not least, we continued working on the mutagenesis approach to eliminate the mutation in clone C5. It was sent for sequencing...

Week 23

Cras justo odio, dapibus ac facilisis in, egestas eget quam. Donec id elit non mi porta gravida at eget metus. Nullam id dolor id nibh ultricies vehicula ut id elit.

Browse gallery

Methods:

Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. .

Overview
Lab book

test

Schematic representation of DelH cluster and structure of delftibactin.

Restriction Digest and Ligation Strategy

PCR amplification of the 18 Kb DelH fragment as sub fragments F1 (10 Kb) and F2 (8 Kb)
Assembly of backbone pSB6A1-Arac-lacZ by PCR amplification of fragments from BioBricks
Ligation of the construct DelH F1 + DelH F2 + backbone pSB6A1-Arac-lacZ
Transformation of E. coli TOP10 with DelH plasmid
Characterization of positive (blue) colonies by colony PCR

Vector Maps, Primers and BioBricks

Vector map of the pHM01:DelH plasmid.

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB4K5	J04450	Spring 2012	1	5G	Backbone for DelA-G,OP,L	Kanamycin
pSB1AK3	I732019	Spring 2012	4	12G	lacZ reporter gene	Kanamycin, Ampicillin
pSB2K3	I0500	Spring 2012	1	14N	AraC promoter	Kanamycin
pSB6A1	J04450	Spring 2012	1	1K	Backbone for DelH	Ampicillin
pSB1C3	J04450	Spring 2012	1	3A	Backbone for Indigoidine	Chloramphenicol

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting SalI	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

29-04 - 05-05-13

Generation of Plasmid Backbones

Transformation of Biobricks

Part of the registry	Plate of 2012	Well	Resistance
pSB4K5 (insert=J04450)	1	5G	Kanamycin
pSB6A1 (insert=J04450)	1	1K	Ampicillin
lacZ (I732019) in pSB1AK3	4	12G	Kanamycin, Ampicillin
AraC (I0500) in pSB2K3	1	14N	Kanamycin
pSB1C3 (insert=J04450)	1	3A	Chloramphenicol

Added 10 µl H₂O to each well
Incubated for 10 min at RT
Thawed 5x chemical competent E.coli Top10
3 µl of plasmid DNA were added
Incubated for 10 min on ice
Heat shock for 40 s at 42.2°C
Incubated for 10 min on ice
Added 500 µl LB Medium
Incubated at 37°C for 40 min
Centrifuged 120 at 5,000 rpm, supernatant discarded
Pellet resuspended in remaining medium
Plated on plates with the corresponding antibiotics (as shown in the table above, section: resistances)
Incubated for 2 days at RT
One colony was picked from each plate and incubated over night at 37°C in LB medium with the antibiotic listed above

Result

All 5 parts from the Registry Distribution 2012 were successfully transformed in E.coli Top10 except for the one containing the AraC promotor.

Amplification of DelH Fragments

Design of Primers

Identifier	Order date	Note	Sequence
DN01:DelH_f1_PacI_fw	03-05-2013	Amplification of DelH F1, with RBS and adding PacI restriction site	TTTT TTAATTAA TCACACAGGAAAGTACTAG ATGGACCGTGGCCGCCTGC GCCAAATCG
DN02:DelH_f1_SalI_rev	03-05-2013	Amplification of DelH F1 until SalI restriction site	TTTT GTCGACCAACACCTGTGCCTGC
DN03:DelH_f2_SalI_fw	03-05-2013	Amplification of DelH F2 starting at SalI restriction site	TTTT GTCGACTGGATGGAGCCTGGTGAAAG
DN04:DelH_f2_KpnI_rev	03-05-2013	Amplification of DelH F2, adding KpnII restriction site	TTTT GGTACC TCAGTCCAGCGCGTACTCCAG
DN05:AraCbb_KpnI_fw	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding KpnI site	TTTT GGTACC AAAGAGGAGAAATACTAGATGACCATG
DN08:AraCbb_PacI_rev	03-05-2013	Amplification of backbone for DelH (pSB6A1-AraC-lacZ), adding PacI site	TTTT TTAATTAA GCTAGCCCAAAAAAACGGGTATG

Overview
Lab book

test

BioBricks

Backbone	Part	Distribution	Plate	Well	Usage	Resistance
pSB1A3	I13453	Spring 2012	1	1F	AraC promoter	Ampicillin
pSB1A3	K206000	Spring 2012	4	8G	AraC promoter	Ampicillin

06-05 - 12-05-13

Amplification of BioBricks

Miniprep of BioBricks

Miniprep was performed using Qiagen kit and eluted in 35 µl ddH₂O.
From 500 µl of liquid culture, a glycerol stock was prepared as described in Preparing glycerol stocks.

Result

DNA concentration was determined using nanovue.

Sample	Concentration [ng/µl]
pSB4K5	21
pSB6A1	47
lacZ	45
pSB1C3	23

Generation of Plasmid Backbones

Restriction Digest of BioBrick pSB6A1

Component	Amount [µl]
PSB6A1 DNA	32.5
BSA (10x)	5
NEB2 buffer (10x)	5
Enzymes (EcoRI-HF and PstI)	1.5 each
ddH₂O	4.5

Result

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified DelH fragment 1 , l6-7:amplified DelH fragment 2,l8:2log, l9: P3 (pSB1C3)

The fragments of plasmids pSB4K5 and pSB1C3 show the expected pattern.

=> BioBrick backbone was cut and gel isolated.

Generation of LacZ Fragment

Restriction Digest of BioBrick pSB1AK3 Conditions A

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB3 buffer (10x)	5
Enzymes (XbaI and PstI)	1.5 each
ddH₂O	4.5

Incubation for 1 h at 37°C

Result

The restriction mix was loaded onto a 1% agarose gel using 6 µl gene ruler marker.

Fig. 2.1: Restriction results of 06-05. l1:2log, l2: P1 (pSB4K5),l3:2log, l4-5:amplified F1 for Backbone (pSB6A1), l6-7:amplified fragment 2 for Backbone (lacZ),l8:2log, l9: P3 (pSB13)

The fragments show the expected pattern.

=> LacZ insert were cut and gel isolated.

Restriction Digest of BioBrick K173004(lacZ) Conditions B

Component	Amount [µl]
pSB1AK3 DNA	8.3
BSA (10x)	5
NEB4 buffer (10x)	5
Enzymes (XbaI & SalI-HF)	1.5 each
ddH₂O	28.7

Purification was performed with Qiagen Nucleotide removal Kit and eluted in 38.5 µl ddH₂O

Result

2.5 µl were measured with the Nanovue. The measurement proved the failure of miniprep.

Restriction Digest of BioBrick K173004(lacZ) Conditions C

Component	Amount [µl]
pSB1AK3 DNA	32.5
BSA (10x)	5
NEB 3 buffer (10x)	5
Enzyme (PstI)	1.5
ddH₂O	-

Result

Fig.2.2 Gel of cut lacZ (loaded 20 µL)
, l1-2: lacz & pSB1AT,l3:2log ladder
=> lacZ was cut out

=>The band was too high on gel and discarded, because we cannot be sure if it really is lacZ or the backbone of the lacZ plasmid.

Generation of AraC Fragment

Amplification of BioBricks containing I13453 and K206000

The transformation was performed as described on 03-05 and incubated ON at 37°.

Amplification of DelH F1

PCR Conditions F1.W2.A

Reagent	DelH F1	DelH F1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1
	62	5
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 10 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l1:2log ladder, l5-6:DelH-F2
no specific band at 10 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.B

Reagent	DelH-fragment1	DelH-fragment1
Expected length [Kb]	10	10
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f1_PacI_fw	0.5 µl DelH_f1_PacI_fw
Primer 100 µM rev	0.5 µl DelH_f1_SalI_rev	0.5 µl DelH_f1_SalI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1
30	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.4 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2:DelH-F1 amplified from DNA, l3:DelH-F1 amplified from cells
no specific band at 10 Kb

PCRs showed only unspecific bands.

=> Further optimize PCR conditions.

PCR Conditions F1.W2.C

Reagent	DelH F1	DelH F1	DelH F1	DelH F1
Expected length [Kb]	10	10	10	10
Template	1 µl D. acidovorans normal	1 µl D. acidovorans normal	1 µl D. acidovorans 1:25	1 µl D. acidovorans 1:25
DelH_f1_PacI_fw	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
DelH_f1_SalI_rev	0.5 µl normal	0.5 µl 1:10	0.5 µl normal	0.5 µl 1:10
Phusion Master Mix (2x)	25 µl	25 µl	25 µl	25 µl
DMSO	-	-	2.5 µl	2.5 µl
ddH₂O	23 µl	23 µl	20.5 µl	20.5 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	62	5
	72	2:45 min
1	72	5 min
1	4	inf

Result

Fig.2.5 Gel of DelH-fragment 1 (loaded 20 µL)
l1:2log ladder, l2-9: F1 with different conditions => l9 shows the best match

PCR with DMSO and 1:10 diluted primer looked best.

=> Gel extraction performed.

Amplification of DelH F2

PCR Conditions F2.W2.A

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
16	98	1
	66(↓0.5°C)	5
	72	3:40 min
14	98	1 s
	62	5 s
	72	3:40 min
1	72	5 min
1	4	inf

Result

Expected band: 8 Kb

Fig.2.3 Gel of amplified DelH-fragment 1 & fragment 2 (loaded 20 µL)
l1:2log ladder, l2-3:DelH-F1, l4:2log ladder, l5-6:DelH-F2
no specific band at 8 Kb

Different unspecific bands were observed.

=> Further optimize PCR conditions.

PCR Conditions F2.W2.B

Reagent	DelH F2	DelH F2
Expected length [Kb]	8	8
Template	1 µl D. acidovorans glycerol stock	1 µl D. acidovorans DNA
Primer 100 µM fw	0.5 µl DelH_f2_SalI_fw	0.5 µl DelH_f2_SalI_fw
Primer 100 µM rev	0.5 µl DelH_f2_KpnI_rev	0.5 µl DelH_f2_KpnI_rev
Phusion Master Mix (2x)	25 µl	25 µl
ddH₂O	23 µl	23 µl

Cycles	Temperature [°C]	Time [s]
1	98	10
30	98	1 s
30	72	2:45 min
1	72	5 min
1	4	inf

Results

Expected band: 8 Kb

Fig.2.6 Gel of amplified DelH-fragment 1 (loaded 20 µL)
l1:DelH-F1 amplified from DNA, l2:DelH-F1 amplified from cells, l3:2log ladder
no specific band at 8 Kb

Gel shows the expected specific band at 8 Kb.

=> DelH F2 was thus successfully amplified from the glycerol stock.

Overview
Lab book

test

Schematic representation of DelH cluster and structure of delftibactin.