From 2013.igem.org

(Difference between revisions)

Latest revision as of 01:37, 29 October 2013

Del Rest. Creating a 32 kb plasmid.

Week 10

This week the project "DelRest" was launched, which aims at creating a single, 32 kb plasmid enabling the expression of most genes from the D. Acidovorans Del cluster, namely DelA-G and DelL-P (note: the 18 kbp gene encoding DelH is cloned onto a seperate plasmid). Due to the shere size and complexity of the DelRest construct, we decided to use Gibson cloning. This weeks goal was amplify the pSB4K5 backbone from the partsregistry with primers giving the intended overlaps as well as the desired genes from our host organism D. Acidovorans . Therefore, Gibson primers for the amplification of the target backbone pSB4K5 were designed, which also introduce a Gibson-overlap to DelA, the first gene present in the Del cluster. Furthermore Gibson primers for amplifying the fragments DelA-G and DelO-P were ordered. The last Gibson primer pair used to amplify DelL consequently carries the required overlap to the beginning of the mRFP reporter present the pSB4K5 insert part BBa_J04450. Check out our vectormap if you are curious about the detailed cloning strategy and primer design.

Week 11

During the past week we managed to amplify a fragment of 11 kbp encoding the genes DelA-F from genomic DNA of D. Acidovorans. We were further able to amplify the backbone fragment from pSB4K5 carrying the desired overlaps to the corresponding fragments to be amplified from the Del cluster. We also succeeded in the amplification of the very last gene in our construct, DelL. Unfortunately, the amplification of DelF-G and DelO-P turned out to be more difficult than expected. Since our initial plan, which required the amplification of DelO-P using a Gibson primer which introduces an overlap to DelL and furthermore introduces an artificial ribosom binding site did not work out, we changed our strategy. We orderd shorter versions of all our Gibson primers. Using these shorter primers not bearing any overlaps to other fragments, we will try to amplify the desired genes in order to obtain a specific template for the reamplification with the primers carrying the needed overlaps. Furthermore, we will optimize the PCR conditions for the amplification of the DelF-G fragment.

Week 12

By the end of last week we found out, that the short primers we had ordered did not improve amplification of the missing fragments from D. Acidovorans. Additionly, further analysis of the Delftibactin cluster, led to the discovery of a predicted promoter present in front of DelO-P potentially essential for DelO-P expression. Therefore, we not only decided to design new primers for the amplyfication of DelF-G, but also modifie the entire strategy concerning the DelO-P fragment. To ensure the expression of DelO-P in our target organism E.coli we decided to amplify DelO-P together with its putative promoter. In consequence, we ordered new primers for DelO-P and also for the last DelA-G fragment in order to introduce the required new overhang to the new DelO-P fragment. The correlating primers can be found in our new vector map.

Week 13

In the previous week, several of the newly ordered primer pairs improved our PCRs for DelO-P and DelF-G. However, results were not convincing enough to use these amplicons for Gibson assembly. Therefore, we spend this week optimizing the PCRs for the abovementioned fragments. In addition we validated the amplicon of DelG with restriction digest. Validation of the other PCR products did not succeed, mostly due to very low amount of DNA.

Week 14

We were still struggeling with getting the correct amplicons for the fragments encoding DelF-G as well as DelO-P. Furthermore, the restriction digests of the already successfully amplified fragments needed to be repeated using higher amounts of DNA, as results of the previous test digests were rather inconclusive. Furthermore, samples of these fragments were send for sequencing.

Week 15

Single read sequencing of the PCR amplified fragments DelA-E, DelL as well as the backbone pSB4K5 was carried out by GATC. We blasted the obtained seqeuences against the reference sequence based on the D. acidovorans SPH-1 strain available on NCBI. Although our sequence matched to the reference sequence, we found a significant number of missmatches, which was too diverse and high to be simply explained by random mutations introduced by our polymerase during PCR (note: we used a high-fidelity proofreading polymerase suitable for GC-rich templates and long amplicons). We thus hypothesized that the SPH-1 strain based on which our cloning strategy was designed might have a significant number of single-nucleotide polymorphisms in the Del cluster compared to the D. acidovorans DSM-39 strain, which we used as template for all PCRs (note: there is no complete genomic sequence available for the DSM-39 strain on NCBI). We further hypothesized, that this difference in sequence between the DSM-39 strain used as PCR template and the SPH-1 strain based on which our primers were designed could explain our troubles with the PCR amplifications of DelF-G and DelO-P. In consequence, we ordered the SPH-1 strain from the DSMZ in order to obtain a suitable template for our PCRs. This solved all our PCR problems right away and we were able to get all amplicons required for cloning the DelRest construct within this week. Furthermore, we successfully validated our amplicons by restriction digest and sequencing.

Week 16

Last week we successfully amplified all the fragments needed to complete the DelRest cloning. Therefore, we went ahaed and performed Gibson assembly in order to assembel the final pFSN plasmid carrying bearing the DelRest genes. The assembly mix was transformed into E. coli DH10beta electrocompetent cells. Screening PCRs showed that the assembly was successful, calling for futher validation of the clones.

Week 17

From colonies which were positive for screening last week, we rescued 3 plasmids. Test restriction digest were conducted and showed our clones to be correct.

Week 18

We send one of our DelRest constructs that showed the right restriction pattern in the test digest for sequencing. As it would be quite costly to sequence the whole 32 kb plasmid, we focused on the ligation sites between the different assembly fragments, which are most prone to insertion of errors. Although all insert fragments sequenced, including the ligation sites between DelA and DelF, DelO-P and DelL, were 100 % correct, we detected a mutation within the mRFP cds (note: we wanted to use mRFP in order to confirm expression from our DelRest plasmid). FACS analysis of E. coli bearing the DelRest construnct confirmed that mRFP expression was impaired, likely due to the corresponding mutation. However, as mRFP was only meant to be a general expression control on our construct, we did not start correcting out construct by mutagenesis. Instead, we started preparing samples for an SDS page in order to directly proof the expression of the Del genes by Coomassie staining.

Week 19

The Coomassie staining we carried out last week did not display all expected bands clearly. This occured most likely due to the low amount of protein loaded onto the corresponding SDS page. Therefore the SDS page was repeated. This expression analysis confirmed the results indicated by the previous SDS-page. We were able to show that DelE and DelG are expressed at a detectable level. As we could confirm the successful cloning and functioning of the DelRest expression plasmid named pFSN (for Florian-Sophie-Nils :)) the DelRest subproject was succssfully completed and the personal resources of the DelRest group were shifted to the DelH group as well as the wiki.

Identifier	Order date	Note	Sequence
FS_01: pSB4K5_DelA_rv	20-13-06-28	Amplification of pSB4K5 from the iGEM Distribution. Gibson Primer with overhang to DelA introducing the RBS BBa_B0035	TCGCGGCGATCCGGTACTGCGCCTCTGTTGAACATCTGATATTCT CCTCTTTAATCGACAGATTGTGTGAAATTGTTATCCGCTCAC
FS_02: DelAG_1_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTCAACAGAGGCGCAGTACCGGATC
FS_03: DelAG_1_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTCGGAGACGATGTGGTGCATCAC
FS_04: DelAG_2_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CTGCAGGCCAATGAGCACATCCTG
FS_05: DelAG_2_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	CACAGGTGGTAGATGGCGTC
FS_06: DelAG_3_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	ATTGCGAGGACTTGCTCGATG
FS_07: DelAG_3_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	TTTGCTGCAGCGCCAGCACATCGAG
FS_08: DelAG_4_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GTACGGCCTATCACATCAGCG
FS_09: DelAG_4_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAAGCTCAGCAGGTTGGGCGAGACG
FS_10: DelAG_5_fw	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome.	GAATTTTGTTCCACCACCTGCTG
FS_11: DelAG_5_rv	2013-06-28	Amplification of DelA-G from Delftia acidovorans genome. Gibson Primer with overhang to DelOP	CTTGAGCAGGCGCAGTACCTCGGAGGGCGGTCGGCTGGCGTTTTCCATGATTCAGG TTTCCTGTGTGAAGCTCATCTCAGATATCTCCCAGAGTTTCGAGAAAG
FS_11: DelAG_5_short_rv	2013-08-02	Amplification of DelA-G from Delftia acidovorans genome.	TCAGATATCTCCCAGAGTTTCGAGAAAG
FS_12: DelOP_fw	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome.	GAATCATGGAAAACGCCAGCCGAC
FS_13: DelOP_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	CAATGTTGGAGGGGCCGAAGCCGATGCCGATCAGCGGGTGGGTTTGCATGGAAGGT CCTTTCATTGGGTCGATGCGTCCAGTGTCACACCGTGGTGTCTGCAGGCG
FS_13: DelOP_short_rv	2013-06-28	Amplification of DelO-P from Delftia acidovorans genome. Gibson Primer with overhang to DelL	TCACACCGTGGTGTCTGCAGGCG
FS_14: DelL_fw	2013-06-28	Amplification of DelL from Delftia acidovorans genome.	CAAACCCACCCGCTGATCGGCATC
FS_15: DelL_mRFP_pSB4K5_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	GAAACGCATGAACTCTTTGATAACGTCTTCGGAGGAAGCCATCTAGTATTTCTCCTC TTTCTCTAGTATCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_15: DelL_mRFP_pSB4K5__short_rv	2013-06-28	Amplification of DelL from Delftia acidovorans genome. Gibson Primer with overhang to BBa_J04450	TCAGTCCTGCAGCGCCAGCTGTTCTGTG
FS_16: mRFP_pSB4K5_fw (Del)	2013-06-28	Amplification of pSB4K5 from iGEM Distribution. Gibson Primer	GCTTCCTCCGAAGACGTTATC

PCRs from D.acidovorans DSM-39
Gene(s)	Fragment	Primer combination	Successful?
DelA DelB DelC DelD DelE DelF DelG	DelA-E	FS_02 and FS_03
	DelA-F	FS_02 and FS_05
	DelA-G	FS_02 and FS_07
	DelE-G	FS_04 and FS_07
	DelF-G	FS_06 and FS_07
		FS_06 and FS_09
		FS_06 and FS_11
	DelG	FS_08 and FS_11
DelO DelP DelL	DelO-P	FS_12 and FS_13
DelO DelP DelL	DelL	FS_14 and FS_15
pSB4K5	pSB4K5	FS_01 and FS_16

what	µL
D. acidovorans DSM-39	1
FS_02: (1/10)	1
FS_03: (1/10)	1
Phusion Master Mix	10
DMSO	1/-
dd H₂O	6/7

Biorad MyCycler
Cycles-PCR	temperature [°C]	Time [s]
1	98	5
12	98	1
	66 ↓ 0.5	5
	72	2:30 min
18	98	1
	63	5
	72	2:30 min
1	72	10 min
1	4	inf

µL 1st PCR	what	µL 2nd PCR
1	D. acidovorans DSM-39	1
2.5	FS_02 (1/10)	2.5
2.5	FS_05 (1/10)	2.5
25	Phusion Master Mix	25
-	DMSO	2.5
19	dd H₂O	19

@@ Line 1: / Line 1: @@
-{{:Team:Heidelberg/Templates/bootstrap-css}}
-{{:Team:Heidelberg/Templates/basic-css}}
-{{:Team:Heidelberg/Templates/style2-css}}
-{{:Team:Heidelberg/Templates/scrollbar-css}}
 {{:Team:Heidelberg/Templates/Navigation}}
+{{:Team:Heidelberg/Templates/scrollbar-css}}
 <html>
 <style type="text/css">
@@ Line 11: / Line 9: @@
     p  {
        font-size:14px;
+      text-align:justify;
+}
+   .carousel-inner {
+      margin-top:20%;
+}
+.tab-content .wikitable {
+ font-size:9pt;
 }
 </style>
    <div class="container">
              <!--Project Description-->
-             <div style="margin-top:80px">
+             <div>
-                         <h1><span style="font-size:180%;color:#FFCC00;">Del Rest.</span><span class="text-muted" style="font-size:120%"> Creating a 32 kbp plasmid.</span></h1>
+                         <h1><span style="font-size:180%;color:#FFCC00;">Del Rest.</span><span class="text-muted" style="font-size:120%"> Creating a 32 kb plasmid.</span></h1>
-                         <p>Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna aliquyam erat, sed diam voluptua. At vero eos et accusam et justo duo dolores et ea rebum. Stet clita kasd gubergren, no sea takimata sanctus est Lorem ipsum dolor sit amet.</p>
              </div>
              <div class="row">
-             <div class="col-sm-4">
+             <div class="col-sm-12 col-md-6">
              <!--Months-->
-                 <ul class="pagination" style="margin-bottom:2%; margin-left:8%;">
+                 <ul class="pagination" style="margin-bottom:2%; margin-left:17%;">
                      <!--<button type="button" class="btn btn-default">May</button>
@@ Line 65: / Line 70: @@
                                        <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-This week the project "DelRest" was launched, which aims for creating a single, 32 kb plasmid enabling the expression of all genes from the <i>D. Acidovorans </i> Del cluster, namely DelA-G and DelL-P (note: the 18 kbp gene encoding DelH is cloned onto a seperate plasmid). Due to the shere size and complexity of the DelRest construct, we desided to use Gibson cloning.
+This week the project "DelRest" was launched, which aims at creating a single, 32 kb plasmid enabling the expression of most genes from the <i>D. Acidovorans </i> Del cluster, namely DelA-G and DelL-P (note: the 18 kbp gene encoding DelH is cloned onto a seperate plasmid). Due to the shere size and complexity of the DelRest construct, we decided to use Gibson cloning.
+This weeks goal was amplify the pSB4K5 backbone from the partsregistry with primers giving the intended overlaps as well as the desired genes from our host organism <i>D. Acidovorans </i>.
-???The goal of this week was to amplify our previously assembled backbone with the intended overlaps as well as the desired genes from our host organism <i>D. Acidovorans </i>.???
+Therefore, Gibson primers for the amplification of the target backbone pSB4K5 were designed, which also introduce a Gibson-overlap to DelA, the first gene present in the Del cluster. Furthermore Gibson primers for amplifying the fragments DelA-G and DelO-P were ordered. The last Gibson primer pair used to amplify DelL consequently carries the required overlap to the beginning of the mRFP reporter present the pSB4K5 insert part BBa_J04450. Check out our vectormap if you are curious about the detailed cloning strategy and primer design.
-Therefore Gibson primers for the amplification of the target backbone pSB4K5 were designed, which also introduce a gibson-overlap to DelA, the first gene present in the Del cluster. Furthermore Gibson primers for amplifying the fragments DelA-G and DelO-P were ordered. The last Gibson primer pair used to amplify DelL consequently carries the required overlap to the beginning of the mRFP reporter present the pSB4K5 insert part BBa_J04450. Check out our vectormap if you are curious about the detailed primer design.
                                         </p>
@@ Line 80: / Line 83: @@
                                    <h1>Week 11</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-During the past week we managed to amplify a single fragment of 11 kbp including the genes DelA to DelF from genomic DNA of <i>D. Acidovorans</i>. Furthermore we were able to equip our biobrick backbone pSB4K5 with the desired overlaps to the genes of the Delftibactin cluster. We also succeeded in the amplification of the very last gene in our construct, DelL. However still a lot of work has to be done, since the amplification of DelF-G and DelO-P turned out to be more complicated. Since our initial plan, to amplify DelO-P with a Gibson primer which includes an overlaps to DelL and furthermore introduces an artificial ribosom binding site, turned out to be quite ambitious, we orderd shorter versions of all our Gibson primers, used to amplify genomic DNA. Using these shorter primers which should anneal better we will try to preamplify the desired genes in order to obtain a specific template for the amplification with the needed overlaps. Furthermore we will optimize the PCR conditions for the amplification of DelF-G.
+During the past week we managed to amplify a fragment of 11 kbp encoding the genes DelA-F from genomic DNA of <i>D. Acidovorans</i>. We were further able to amplify the backbone fragment from pSB4K5 carrying the desired overlaps to the corresponding fragments to be amplified from the Del cluster. We also succeeded in the amplification of the very last gene in our construct, DelL. Unfortunately, the amplification of DelF-G and DelO-P turned out to be more difficult than expected. Since our initial plan, which required the amplification of DelO-P using a Gibson primer which introduces an overlap to DelL and furthermore introduces an artificial ribosom binding site did not work out, we changed our strategy. We orderd shorter versions of all our Gibson primers. Using these shorter primers not bearing any overlaps to other fragments, we will try to amplify the desired genes in order to obtain a specific template for the reamplification with the primers carrying the needed overlaps. Furthermore, we will optimize the PCR conditions for the amplification of the DelF-G fragment.
                                    </p>
@@ Line 92: / Line 95: @@
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-By the end of last week we decided that the short primers we had ordered in the previous week did not improve amplification of the missing genes from <i>D. Acidovorans </i>. Also the amplification of DelF-G did not proceed as expected. Additionly, further analysis of the Delftibactin cluster, led to the discovery of another putative promotor in front of DelO-P. Therefore we not only decided to design new primers for the sequenceregion of DelFG but also modified the entire strategy and our construct in concerns of DelOP. To ensure the expression of DelOP in our target organism <i> E.coli </i> we decided to introduce this promotor in our final vector. Logically new primers were ordered for this region but as we still want to use Gibson cloning also the very last fragment of DelA-G has now to be amplified with an overlap, matching the promotor in front of DelOP. The correlating primers can be found in our new vector map.
+By the end of last week we found out, that the short primers we had ordered did not improve amplification of the missing fragments from <i>D. Acidovorans. </i> Additionly, further analysis of the Delftibactin cluster, led to the discovery of a predicted promoter present in front of DelO-P potentially essential for DelO-P expression. Therefore, we not only decided to design new primers for the amplyfication of DelF-G, but also modifie the entire strategy concerning the DelO-P fragment. To ensure the expression of DelO-P in our target organism <i> E.coli </i> we decided to amplify DelO-P together with its putative promoter. In consequence, we ordered new primers for DelO-P and also for the last DelA-G fragment in order to introduce the required new overhang to the new DelO-P fragment. The correlating primers can be found in our new vector map.
                                    </p>
@@ Line 103: / Line 106: @@
                                    <h1>Week 13</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-In the previous week several of the new primers improved our PCRs for DelO-P slightly. Nevertheless results were not convincing enough to use the amplified fragments for Gibson Assembly. The same encounted for the amplification of DelF-G. Here various strategies where conducted. Though none of these led to an entirely satisfying ampl of the genes DelF and DelG, we were able to amplify regions of the Delftibactin cluster which we could not amplifý with the initial primers. Therefore this week will be used for optimization of these PCRs as well as for validation of the amplicons we were already able to obtain in well established amplifications. Validation will be carried out with various restriction digests. PCR products showing positive digests will be prepared for single read sequencing to validate constructs before Gibson Assembly.
+In the previous week, several of the newly ordered primer pairs improved our PCRs for DelO-P and DelF-G. However, results were not convincing enough to use these amplicons for Gibson assembly. Therefore, we spend this week optimizing the PCRs for the abovementioned fragments. In addition we validated the amplicon of DelG with restriction digest. Validation of the other PCR products did not succeed, mostly due to very low amount of DNA.
 </p>
                                  </div>
@@ Line 113: / Line 116: @@
                                    <h1>Week 14</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-Since last weeks aims beeing amplification of the missing fragments within the sequence region of DelF to DelG as well as amplification of DelO-P did not succeed and validations of all PCR products failed, this weeks goals are identical to those of the previous week.  Additionally to the aim of amplifying the missing fragments, restriction digests of the successfully amplified fragments will be carried out using higher amounts of DNA. Furthermore samples of these PCRs will be prepared for single read sequencing.
+We were still struggeling with getting the correct amplicons for the fragments encoding DelF-G as well as DelO-P. Furthermore, the restriction digests of the already successfully amplified fragments needed to be repeated using higher amounts of DNA, as results of the previous test digests were rather inconclusive. Furthermore, samples of these fragments were send for sequencing.
 </p>
                                  </div>
@@ Line 124: / Line 127: @@
                                    <h1>Week 15</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-Single read sequencing carried out by GATC and consequent alignment of the sequencing results obtained from <i>D. acidovorans</i> DSM-39 and the reference Sequence of <i>D. acidovorans SPH-1</i> (6.8 Mbp, NCBI Genome) revealed significant differences between the two strains of <i>D. acidovorans</i>. As result of this sequence analysis, the strain D. acidovorans SPH-1 was ordered from the DSMZ to have the suitable template for the primers we designed so far. Furthermore this should avoid issues which might occure in the Gibson Assembly in case mismachtes in the primers to the sequence of DSM-39 are present. Consequently all amplifications carried out before week 15 have to be repeated, conditions of the establihsed PCRs will be maintained, conditions for the missing fragments will be further optimized.
+Single read sequencing of the PCR amplified fragments DelA-E, DelL as well as the backbone pSB4K5
-Afterwards all fragments will be validated by restriction digests and single read seqencing.
+was carried out by GATC. We blasted the obtained seqeuences against the reference sequence based on the <i>D. acidovorans SPH-1</i> strain available on NCBI. Although our sequence matched to the reference sequence, we found a significant number of missmatches, which was too diverse and high to be simply explained by random mutations introduced by our polymerase during PCR (note: we used a high-fidelity proofreading polymerase suitable for GC-rich templates and long amplicons). We thus hypothesized that the SPH-1 strain based on which our cloning strategy was designed might have a significant number of single-nucleotide polymorphisms in the Del cluster compared to the <i>D. acidovorans</i> DSM-39 strain, which we used as template for all PCRs (note: there is no complete genomic sequence available for the DSM-39 strain on NCBI). We further hypothesized, that this difference in sequence between the DSM-39 strain used as PCR template and the SPH-1 strain based on which our primers were designed could explain our troubles with the PCR amplifications of DelF-G and DelO-P. In consequence, we ordered the SPH-1 strain from the DSMZ in order to obtain a suitable template for our PCRs. This solved all our PCR problems right away and we were able to get all amplicons required for cloning the DelRest construct within this week. Furthermore, we successfully validated our amplicons by restriction digest and sequencing.
 </p>
                                  </div>
@@ Line 135: / Line 138: @@
                                    <h1>Week 16</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-Last week we successfully amplified all the desired genes from the Delftibactin cluster of <i>D. Acidovorans </i>. Furthermore we were able to validate our amplicons with restriction digest ans sequencing. Therefore this weeks goal will be the cloning of our final pFSN plasmid using Gibson Assembly. Afterwards DH10B cells will be transformed with our plasmid by electroporation. Screening PCRs, test restriction digests and sequencings will be conducted to validate the final construct. Afterwards plasmids will be preped for further use and glycerol stocks of DH10B-pFSN will be made.
+Last week we successfully amplified all the fragments needed to complete the DelRest cloning. Therefore, we went ahaed and performed Gibson assembly in order to assembel the final pFSN plasmid carrying bearing the DelRest genes. The assembly mix was transformed into <i>E. coli DH10beta</i> electrocompetent cells. Screening PCRs showed that the assembly was successful, calling for futher validation of the clones.
 </p>
                                  </div>
@@ Line 146: / Line 149: @@
                                    <h1>Week 17</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-Since we were able to rescue 3 plasmids, from colonies which were positive for screening, by the end of last week, this week further colony PCRs, test restriction digests and sequencings will be conducted to validate the final construct. Therefore we will initially focus on clone D8w, as preps of this clone are already available.
+From colonies which were positive for screening last week, we rescued 3 plasmids. Test restriction digest were conducted and showed our clones to be correct.
-Consequently screening primers will be used to check whether all fragments are present in the final vector as well as to sequence the relevant ligation sites for any mutations that might have occured during primer synthesis or assembly.
-Afterwards plasmids will be preped for further use and glycerol stocks of DH10B-pFSN will be made.
 </p>
                                  </div>
@@ Line 160: / Line 160: @@
                                    <h1>Week 18</h1>
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
-All sequencings initialized last week were positive for the ligation sites within the insert including the genes DelA to DelF, DelO-P and DelL, only for the mRFP a mutation was detected. As sequencing results for this particular region, were not absolutly reliable, sequencing will be repeated this week, and analyis for functionality of mRFP will carried out by FACS. Furthermore a SDS page will be conducted to investigate the expression of our target genes.
+We send one of our DelRest constructs that showed the right restriction pattern in the test digest for sequencing. As it would be quite costly to sequence the whole 32 kb plasmid, we focused on the ligation sites between the different assembly fragments, which are most prone to insertion of errors. Although all insert fragments sequenced, including the ligation sites between DelA and DelF, DelO-P and DelL, were 100 % correct, we detected a mutation within the mRFP cds (note: we wanted to use mRFP in order to confirm expression from our DelRest plasmid). FACS analysis of <i> E. coli </i>  bearing the DelRest construnct confirmed that mRFP expression was impaired, likely due to the corresponding mutation. However, as mRFP was only meant to be a general expression control on our construct, we did not start correcting out construct by mutagenesis. Instead, we started preparing samples for an SDS page in order to directly proof the expression of the Del genes by Coomassie staining.
 </p>
                                  </div>
@@ Line 170: / Line 170: @@
                                  <div class="carousel-caption scrollContent2" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                                    <h1>Week 19</h1>
-As the SDS page we carried out last week, did not display all expected bands absolutely certain, probably due to the very low amount of protein loaded, this SDS page will be repeated within week 19. Nethertheless most resources of the DelRest group will from now on be shifted to the cloning of DelH.
+The Coomassie staining we carried out last week did not display all expected bands clearly. This occured most likely due to the low amount of protein loaded onto the corresponding SDS page. Therefore the SDS page was repeated.
+This expression analysis confirmed the results indicated by the previous SDS-page. We were able to show that DelE and DelG are expressed at a detectable level.
+As we could confirm the successful cloning and functioning of the DelRest expression plasmid named pFSN (for Florian-Sophie-Nils :)) the DelRest subproject was succssfully completed and the personal resources of the DelRest group were shifted to the DelH group as well as the wiki.
                                    <p style="font-size:10pt; text-align:justify; position:relative; margin-left:6%;">
 </p>
@@ Line 182: / Line 184: @@
                  </div>
              </div><!-- /.carousel -->
+        </div>
+<div class="col-sm-12 col-md-6" style="margin-top:7%">
+             <div class="jumbotron">
+                <div style="width:100%;">
+<a class="fancybox fancyGraphical" rel="group" href="https://static.igem.org/mediawiki/2013/e/e3/Heidelberg_ga_delf.png">
-            <div class="jumbotron methods" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+    <img style="width:100%; margin-bottom:10px; padding:1%;border-style:solid;border-width:1px;border-radius: 4px; border-color: grey;" src="https://static.igem.org/mediawiki/2013/e/e3/Heidelberg_ga_delf.png"></img>
-                <h2>Methods:</h2>
-                <p style="font-size:10pt; text-align:justify">
+</a>
-                </p>
              </div>
+           </div>
+          </div>
+        </div>
+        </div>
          </div>
-         <div class="col-sm-8">
+      <div class="container">
+        <div class="row">
+         <div class="col-sm-12">
              <!--Start Weekly Labjournal-->
@@ Line 209: / Line 223: @@
                  </div>
                  <div class="jumbotron">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
@@ Line 215: / Line 229: @@
                              <div class="tab-pane active" id="a10">
                                  <p style="font-size:12pt; text-align:justify;">
+                                    </html>{{:Team:Heidelberg/Templates/Del_week10_overview}}<html>
                                  </p>
                              </div>
@@ Line 296: / Line 310: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a11">
                                  <p style="font-size:12pt; text-align:justify;">
+                                    </html>{{:Team:Heidelberg/Templates/Del_week11_overview}}<html>
                                  </p>
@@ Line 381: / Line 396: @@
                  </div>
                      <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
@@ Line 387: / Line 402: @@
                              <div class="tab-pane active" id="a12">
                                  <p style="font-size:12pt; text-align:justify;">
+                                     </html>{{:Team:Heidelberg/Templates/Del_week12_overview}}<html>
                                  </p>
                              </div>
@@ Line 449: / Line 464: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                           <div class="tab-content">
                              <div class="tab-pane active" id="a13">
                                  <p style="font-size:12pt; text-align:justify;">
+                                  </html>{{:Team:Heidelberg/Templates/Del_week13_overview}}<html>
                                  </p>
                              </div>
@@ Line 527: / Line 542: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                           <div class="tab-content">
@@ Line 533: / Line 548: @@
                              <div class="tab-pane active" id="a14">
                                  <p style="font-size:12pt; text-align:justify;">
+                                   </html>{{:Team:Heidelberg/Templates/Del_week14_overview}}<html>
                                  </p>
                              </div>
@@ Line 596: / Line 611: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a15">
                                  <p style="font-size:12pt; text-align:justify;">
+                                   </html>{{:Team:Heidelberg/Templates/Del_week15_overview}}<html>
                                  </p>
                              </div>
@@ Line 683: / Line 698: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a16">
                                  <p style="font-size:12pt; text-align:justify;">
+                                   </html>{{:Team:Heidelberg/Templates/Del_week16_overview}}<html>
                                  </p>
                              </div>
@@ Line 754: / Line 769: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a17">
                                  <p style="font-size:12pt; text-align:justify;">
+                                </html>{{:Team:Heidelberg/Templates/Del_week17_overview}}<html>
                                  </p>
                              </div>
@@ Line 791: / Line 806: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a18">
                                  <p style="font-size:12pt; text-align:justify;">
+                                  </html>{{:Team:Heidelberg/Templates/Del_week18_overview}}<html>
                                  </p>
                              </div>
@@ Line 820: / Line 835: @@
                  </div>
                  <div class="jumbotron weekly">
-                     <div class="scrollContent nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
+                     <div class="nav navbar" data-spy="scroll" data-target="#navbarExample" data-offset="0">
                         <div class="tab-content">
                              <div class="tab-pane active" id="a19">
                                  <p style="font-size:12pt; text-align:justify;">
+                                    </html>{{:Team:Heidelberg/Templates/Del_week19_overview}}<html>
                                  </p>
                              </div>
@@ Line 841: / Line 856: @@
                 </div>
              </div>
+          </div>
+          </div>
          </div>
      </div>
 </div>
 </html>
+{{:Team:Heidelberg/Templates/Footer-Nav}}
 {{:Team:Heidelberg/Templates/Footer-DelRest}}

Team:Heidelberg/Delftibactin/DelRest

From 2013.igem.org

Latest revision as of 01:37, 29 October 2013

Team

Project

Notebook

Parts

Software

Human Practice

Safety

Modeling

Del Rest. Creating a 32 kb plasmid.

Week 10

Week 11

Week 12

Week 13

Week 14

Week 15

Week 16

Week 17

Week 18

Week 19

Strategy

Plasmid backbone part from the partsregistry

Primer pairs, corresponding sequences and usage

Amplification of Del Genes from DSM-39 genome

Goals

Results

06-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

03-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

04-07-2013

Amplification from FS_02 to FS_05; 11.2 kb

05-08-2013

Amplification from FS_02 to FS_07; 16.4 kb

06-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

03-07-2013

Amplification from FS_06 to FS_09; 8.5 kb

Amplification from FS_06 to FS_09; 8.5 kb

Amplification from FS_06 to FS_11; 11.6 kb

05-07-2013

Amplification from FS_06 to FS_07; 5.2 kb

05-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

07-07-2013

Amplification from FS_08 to FS_11; 6.5 kb

04-07-2013

Amplification from FS_12 to FS_13; 2.7 kb

04-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

06-07-2013

Amplification from FS_14 to FS_15; 1.4 kb

05-07-2013

Amplification from FS_01 to FS_16; 4.2 kb

Strategy

Primer pairs, corresponding sequences and usage

Amplification of Del Genes from DSM-39 genome

Goals

Results

08-07-2013

Amplification from FS_02 to FS_03; 5.3 kb

12-07-2013

Amplification from FS_02 to FS_07; 16.4 kb

09-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

11-07-2013

Amplification from FS_04 to FS_11s; 17.5 kb

Amplification from FS_04 to FS_11; 17.5 kb; Phusion II

14-07-2013

Amplification from FS_04 to FS_07; 11.1 kb

09-07-2013

Amplification from FS_08 to FS_11_short; 6.5 kb

13-07-2013

Amplification from FS_10 to FS_11s; 3.3 kb

Amplification from FS_10 to FS_11(s); 3.3 kb

11-07-2013

Amplification from FS_13s to FS_15s; 6.4 kb

12-07-2013