Team:NTU-Taida/Notebook/Journal

From 2013.igem.org

(Difference between revisions)
(→Check and Plasmid DNA extraction (mini-prep):)
 
(26 intermediate revisions not shown)
Line 1: Line 1:
-
{{:Team:NTU-Taida/Templates/Header}}{{:Team:NTU-Taida/Templates/Navbar}}{{:Team:NTU-Taida/Templates/Sidebar-calendar|Title=Journal|Month=July}}{{:Team:NTU-Taida/Templates/ContentStart}}
+
{{:Team:NTU-Taida/Templates/Header}}{{:Team:NTU-Taida/Templates/Navbar}}{{:Team:NTU-Taida/Templates/ContentStart}}
-
 
+
-
=July=
+
-
 
+
-
= 7/1~7/5 =
+
-
Finish RhlR and LasR circuit.
+
-
 
+
-
==7/1==
+
-
 
+
-
===Transform:===
+
<html>
<html>
-
<ol>
+
<div id="Slide" style="width:640px;margin:auto;">
 +
<div class="page-header">
 +
<h1>Journal</h1>
 +
                        <p>Press the <b>month</b> on the picture to enter monthly Journal!</p>
 +
</div>
 +
<div id="myCarousel" class="carousel slide">
 +
            <div class="carousel-inner">
 +
                <div class="item active">
 +
                    <img src="/wiki/images/a/a0/NTU-Taida-schedule-1.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption" >
 +
<h4>December</h4>
 +
<p>Recruited members and Started!</p>
 +
                    </div>
 +
                </div>
 +
                <div class="item">
 +
                    <img src="/wiki/images/c/c5/NTU-Taida-schedule-2.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4>January</h4>
 +
<p>Design thinking working shop for creative ideas.</p>
 +
                    </div>
 +
                </div>
 +
                <div class="item">
 +
                    <img src="/wiki/images/e/e4/NTU-Taida-schedule-3.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4>February</h4>
 +
<p>Primary project discussion.</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/5/5b/NTU-Taida-schedule-4.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4>March</h4>
 +
<p>Wiki study group and discussion.</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <img src="/wiki/images/3/39/NTU-Taida-schedule-5.jpg" width="640px" alt="">
 +
                    <div class="carousel-caption">
 +
<h4>April</h4>
 +
<p>Biobrick came and wet lab started.</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/May"><img src="/wiki/images/2/25/NTU-Taida-schedule-6.jpg" width="640px" alt=""></a>
 +
                    <div class="carousel-caption">
 +
<a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/May">May</a>
 +
<p>Visit professor in Department of Biochemical Science and Technology.</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/June"><img src="/wiki/images/3/32/NTU-Taida-schedule-7.jpg" width="640px" alt=""></a>
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/June">June</a></h4>
 +
<p>Walking on a busy road.</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/July"><img src="/wiki/images/d/d2/NTU-Taida-schedule-8.jpg" width="640px" alt=""></a>
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/July">July</a></h4>
 +
<p>Go to Department of Laboratory Medicine in NTU Hospital</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/August"><img src="/wiki/images/d/d0/NTU-Taida-schedule-9.jpg" width="640px" alt=""></a>
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/August">August</a></h4>
 +
<p>Seminar for IGem teams in NCTU</p>
 +
                    </div>
 +
                </div>
 +
<div class="item">
 +
                    <a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/September"><img src="/wiki/images/a/a7/NTU-Taida-schedule-10.jpg" width="640px" alt=""></a>
 +
                    <div class="carousel-caption">
 +
<h4><a href="https://2013.igem.org/Team:NTU-Taida/Notebook/Journal/September">September</a></h4>
 +
<p>Fighting and fighting!!!</p>
 +
                    </div>
 +
                </div>
 +
            </div>
 +
        </div> 
 +
        <div style="height: 100px">
 +
<ol class="carousel-indicators">
 +
                <li data-target="#myCarousel" data-slide-to="0" class="active">
 +
<img src="/wiki/images/a/a0/NTU-Taida-schedule-1.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="1">
 +
<img src="/wiki/images/c/c5/NTU-Taida-schedule-2.jpg" width="50px" alt=""></li>
 +
                <li data-target="#myCarousel" data-slide-to="2">
 +
<img src="/wiki/images/e/e4/NTU-Taida-schedule-3.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="3">
 +
<img src="/wiki/images/5/5b/NTU-Taida-schedule-4.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="4">
 +
<img src="/wiki/images/3/39/NTU-Taida-schedule-5.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="5">
 +
<img src="/wiki/images/2/25/NTU-Taida-schedule-6.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="6">
 +
<img src="/wiki/images/3/32/NTU-Taida-schedule-7.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="7">
 +
<img src="/wiki/images/d/d2/NTU-Taida-schedule-8.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="8">
 +
<img src="/wiki/images/d/d0/NTU-Taida-schedule-9.jpg" width="50px" alt=""></li>
 +
<li data-target="#myCarousel" data-slide-to="9">
 +
<img src="/wiki/images/a/a7/NTU-Taida-schedule-10.jpg" width="50px" alt=""></li>
 +
            </ol>
 +
</div>
 +
</div>
 +
 +
<!-- Le javascript
 +
    ================================================== -->
 +
    <!-- Placed at the end of the document so the pages load faster -->
 +
    <script src="http://ajax.googleapis.com/ajax/libs/jquery/1.9.1/jquery.min.js"></script>
 +
    <script src="js/jquery.smooth-scroll.min.js"></script>
 +
    <script src="js/bootstrap.min.js"></script>
 +
    <script src="js/bootswatch.js"></script>
 +
<script>//usermenu dropdown
 +
if ($('#pt-logout').length){
 +
// login
 +
$('#nav-login').text('User: ' + $('#pt-userpage').text()).append('<b class="caret"></b>');
 +
$('#nav-edit').attr('href',$('#menubar.left-menu > ul > li > a[href$="edit"]').attr('href'));
 +
$('#nav-history').attr('href',$('#menubar.left-menu > ul > li > a[href$="history"]').attr('href'));
 +
$('#nav-logout').attr('href',$('#pt-logout > a').attr('href'));
 +
$('.dropdown-toggle').dropdown();
 +
}else{
 +
// not login
 +
$('#nav-usermenu').remove();
 +
$('#nav-login').attr('href',$('#pt-login>a').attr('href')).removeAttr('data-toggle');
 +
}
-
<li>Positive feedback circuit:<br>
+
reactiveNavbar();
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;</li>
+
});
-
<li>Control: <br>
+
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;</li>
+
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
+
-
<li>New: <br>
+
-
Pcin, CinR (resistant=C)</li>
+
-
</ol>
+
 +
</script>
 +
</html>
</html>
-
==7/2==
 
-
===Result:===
 
-
There’s no colonies at plates of Pcin and CinR. 
 
-
===Transform:===
 
-
Pcin(resistant=A), CinR (resistant=K)
 
-
===Inoculation and incubation at LB broth===
 
-
<html>
 
-
<ol>
 
-
<li>Positive feedback circuit:</li>
 
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;
 
-
<li>Control:</li>
 
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;
 
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
 
-
</ol>
 
-
</html>
 
-
==7/3==
 
-
===Inoculation and incubation at LB broth===
 
-
Pcin(resistant=A), CinR (resistant=K)
 
-
===Check ===
 
-
<html>
 
-
<ol>
 
-
<li>Positive feedback circuit:</li>
 
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;
 
-
<li>Control: </li>
 
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;
 
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
 
-
</ol>
 
-
</html>
 
-
 
-
==7/4==
 
-
===Check and Plasmid DNA extraction (mini-prep):===
 
-
<html>
 
-
<ol>
 
-
 
-
<li>Positive feedback circuit:</li>
 
-
Pc-A-C-B, Pc-A-C-E, Pc-A-C-B, Pc-D-F-B, Pc-D-F-E, Pc-D-F-G;
 
-
<li>Control:</li>
 
-
PLas-B, PLas-E, PLas-G, PRhl-B, PRhl-E, PRhl-G;
 
-
(A: RBS-RhlR-tt C: PRhl-RBS-RhlR D: RBS-LasR-tt F: PLas-RBS-LasR B: RBS-mCherry-tt E: RBS-GFPmut-tt G: RBS-mRFP-tt )
 
-
<li>Pcin(resistant=A), CinR (resistant=K)</li>
 
-
</ol></html>
 
-
[[File:NTU-Taida-journal-July-1.jpg|500px | thumb|center|]]
 
-
 
-
==7/5==
 
-
===Check: (for plasmid ready to be sequenced)===
 
-
ACB-4, ACE-5, ACG-1, DFB-1, DFE-2, DFE-3, DFE-4, DFE-5, DFG-1, RhlB-1, RhlE-2,  RhlG-1, RhlG-2, LasB3, LasE1, LasG4
 
-
(8,9,11 well failed :DFE-4/DFE-5/ RhlB-1)
 
-
 
-
 
-
[[File:NTU-Taida-journal-July-2.jpg|NTU-Taida-journal-July-2.jpg]]
 
-
 
-
= 7/8~7/12 =
 
-
Construct the circuit for new receptor CinR
 
-
==7/8==
 
-
===Sequence:===
 
-
ACB-4, ACE-5, ACG-1, DFB-1, DFE-2, DFE-3, DFG-1, RhlE-2, RhlG-1, RhlG-2, LasB3, LasE1, LasG4
 
-
===Primer list:===
 
-
<html>
 
-
<table>
 
-
<tr class="tableizer-firstrow"><th>Primer order</th><th>Name</th><th>sequence</th><th>&nbsp;</th></tr>
 
-
<tr><td>BMRC-120</td><td>iGEM2013-pSB1A2</td><td>attaccgcctttgagtgagc</td><td>R</td></tr>
 
-
<tr><td>BMRC-153</td><td>iGEM2013-pSB1A2</td><td>gtgccacctgacgtctaagaa</td><td>F</td></tr>
 
-
<tr><td>BMRC-122</td><td>iGEM2013-mCherry</td><td>gccgtcctcgaagttcatcac</td><td>mcherry</td></tr>
 
-
<tr><td>BMRC-124</td><td>iGEM2013-mRFP</td><td>aacggtaacaccaccgtc</td><td>RFP</td></tr>
 
-
<tr><td>BMRC-126</td><td>iGEM2013-GFP</td><td>cttgtagttcccgtcatcttt</td><td>GFP</td></tr>
 
-
</table>
 
-
</html>
 
-
===Digestion, ligation, transform: 3A assembly and standard assembly both===
 
-
 
-
B0030+CinR
 
-
 
-
==7/9==
 
-
 
-
===Result:===
 
-
The plate of B0030+CinR following 3A assembly was OK. The other following standard assembly failed unexpectedly.
 
-
===Inoculation and incubation:===
 
-
B0030+cinR
 
-
 
-
==7/10==
 
-
 
-
===Plasmid DNA extraction (mini-prep):===
 
-
B0030-cinR
 
-
===Result:===
 
-
A260/A280=1.3
 
-
===Re-inoculation and incubation of plate of B0030-CinR===
 
-
 
-
==7/11==
 
-
 
-
===Plasmid DNA extraction (mini-prep):==
 
-
B0030-cinR
 
-
===Result:===
 
-
A260/A280=1.3
 
-
 
-
==7/12==
 
-
===Digestion: standard assembly only:===
 
-
B0030 CinR
 
-
===Result:===
 
-
There’s no band for B0030
 
-
 
-
=7/15~7/19=
 
-
CinR, LuxR
 
-
==7/15==
 
-
===Ligation:===
 
-
B0030+CinR
 
-
(The certain content in the ependorf labeled B0030 undergone digestion was actually previously digested; thus, concentration was assumed to be low)
 
-
===Transform:===
 
-
B0030-CinR
 
-
pCI
 
-
CI
 
-
 
-
==7/16==
 
-
===Result:===
 
-
Only one colony of plate(B0030-CinR) grew.
 
-
CI are successfully incubated.
 
-
pCI failed to grow.
 
-
===Conclusion: ===
 
-
B0030 threw away.
 
-
 
-
==7/17==
 
-
===Digestion and ligation:===
 
-
B0030 (eppendorf from early stage)
 
-
===Transform:===
 
-
B0030-CinR
 
-
 
-
RBS(B0030)
 
-
 
-
pCI(R0051)
 
-
 
-
LuxR(C0062)
 
-
 
-
pLux(Lux pR, R0062)
 
-
 
-
pConst(J23119)
 
-
 
-
mTagBFP(K592100)
 
-
 
-
Luciferase(J52008)
 
-
 
-
simple Las detecting system(K575024)
 
-
 
-
simple Rhl detecting system(K575033)
 
-
 
-
===Sequence:===
 
-
PcDFE, PcDFG, Pc ACB, Rhl B, Rhl E
 
-
Total 16 tube
 
-
===Sequence results:===
 
-
No single plasmid was correct at all.
 
-
 
-
==7/18==
 
-
===Inoculation and Incubation at LB broth:===
 
-
B0030-CinR, B0030, LuxR, pLux, pConst(J23119), mTagBFP, Luciferase, simple Las detecting system(K575024), simple Rhl detecting system(K575033)
 
-
 
-
==7/19==
 
-
===Check and Plasmid DNA extraction (mini-prep):===
 
-
B0030-CinR, B0030, LuxR, pLux, pConst(J23119), mTagBFP, Luciferase, simple Las detecting system(K575024), simple Rhl detecting system(K575033)
 
-
 
-
[[File:NTU-Taida-journal-July-3.jpg]][[File:NTU-Taida-journal-July-4.jpg]]
 
-
 
-
=7/22~7/31=
 
-
 
-
==7/22==
 
-
==7/23==
 
-
==7/24==
 
-
==7/25==
 
-
==7/26==
 
-
==7/27==
 
-
==7/28==
 
-
==7/29==
 
-
==7/30==
 
-
==7/31==
 
-
 
-
== July ==
 
-
 
-
=2=
 
{{:Team:NTU-Taida/Templates/ContentEnd}}{{:Team:NTU-Taida/Templates/Footer|ActiveNavbar=Notebook}}
{{:Team:NTU-Taida/Templates/ContentEnd}}{{:Team:NTU-Taida/Templates/Footer|ActiveNavbar=Notebook}}

Latest revision as of 02:45, 28 September 2013

Journal

Press the month on the picture to enter monthly Journal!

Retrieved from "http://2013.igem.org/Team:NTU-Taida/Notebook/Journal"