Team:UNITN-Trento/Notebook

From 2013.igem.org

Revision as of 07:49, 12 July 2013 by Ggirelli (Talk | contribs)


This is a template page. READ THESE INSTRUCTIONS.
You are provided with this team page template with which to start the iGEM season. You may choose to personalize it to fit your team but keep the same "look." Or you may choose to take your team wiki to a different level and design your own wiki. You can find some examples HERE.
You MUST have all of the pages listed in the menu below with the names specified. PLEASE keep all of your pages within your teams namespace.


Home Team Official Team Profile Project Parts Submitted to the Registry Modeling Notebook Safety Attributions


You should make use of the calendar feature on the wiki and start a lab notebook. This may be looked at by the judges to see how your work progressed throughout the summer. It is a very useful organizational tool as well.


Filter by DATE
 
Sun Mon Tue Wed Thu Fri Sat
             
             
             
             
             
             
Filter by WHO
Filter by TAG
Add Post to selected Month
Loading the posts...
The first time it might take from a few seconds to a couple of minutes, depending on your connection
[http://2013.igem.org/wiki/index.php?title=Team:UNITN-Trento/Notebook&action=edit Edit this page] | Main Page

Contents

1

First day as iGEMMers at CIBIO (Center for the Integrative Biology)!
We extracted BBa_J45319, BBa_J45320, BBa_J45004 and BBa_J45119 and then transformed them into NEB10β cells.

2

We performed the purification of BBa_J45320, BBa_J45119, BBa_J45700 (obtained from NEB10β colonies transformed by Viola, Emil and Pedro last week) following the “Wizard® Plus SV Minipreps DNA purification System” protocol. After the quantification through NanoDrop, we digested the plasmid with EcoR I and Pst I to obtain the devices. To verify the correct results of our purification we did an electrophoresis run.

3

Since we didn't obtained our product using the Phusion PCR, we tried again to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited the same primers used in our previous attempt (see 06-06-2013).

For the protocol used see the RBC Taq PCR protocol.. When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).

Results:

As you can see from our gel image, our product is present in both reactions (TAQ and TAQ+Phusion). After purifying our products we find out that the concentration of DNA that we obtained is too low (about 5ng/ul) maybe for an experimental error in setting the PCR program. For this reason, our team is going to redo the PCR reaction again.

4

We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.

Foward: GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT Reverse: CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAG

For the protocol used see the Phusion PCR protocol.. When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).

Results:

As you can see from our gel image, our product is not present. The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!

5

We've tried another combination to maximize the outputs of the PCR done to amplify the SAMsynthetase synthase gene from an extract of E.coli genomic DNA (strain MG1655). This time we used the RBC Taq DNA Polymerase protocol but with a mix of this polymerase (0.25 ul) and the Phusion polymerase (0.3 ul). We've prepared two identical samples to see who is the better PCR maker! :)

As you can see from the picture we both obtained great results

6

We purified the products of SAMsynthetase and pSB1C3 PCR performed by Gire and Pedro following the illustra™ GFX™ PCR DNA and Gel Band Purification Kit protocol. After the quantification with NanoDrop, we did the ligation reaction.

7

We extracted BBa_K143012, BBa_K823000, BBa_K823002 and BBa_K823003 and then transformed them into NEB10β cells.

8

We purified the PCR (third attempt) products of SAMsynthetase and pSB1C3 linearized vector following the Quick Reference protocol. After that, we quantified them using the nanodrop instrument.

Quantification results
Sample SAM Synthetase pSB1C3
1 18,6 ng/ul 21,6 ng/ul
2 16,2 ng/ul 16 ng/ul

That's definetely not a good result, however we will continue working with them.

9

To understand if our Neb10β cells and all our reagents for transformation worked well, we transformed 200 ul of cells with 1 ul of pSB1C3 with RFP, previously purificated. As you can see from the picture we've done a nice job!!

10

We took the ligation products (SAMsynthetase + pSB1C3 in two different rapports 2:1 and 1:!) done by Caterina and Fabio in the morning and we transformed it in NEB10 cells. We've also prepared some inocula from the plates of the devices extract in CiBio (BBa_J45700, BBa_J45320, BBa_J45119)in LB with the correct antibioticum to have a lot of materials to work on.

11

We prepared some agar plates with tetracyclin (10ug/ml) and some Luria Broth. Then we extracted, transformed in competent cells and plated the following parts :
part plasmid plate colonies
Bba_J45119 pSB1AT3 amp, tet 10µg/ml, tet 50µg/ml only in amp plate
Bba_J45320 pSB1AT3 amp, tet 10µg/ml, tet 50µg/ml only in amp and tet 10µg/ml
Bba_J45 700 pSB1AK3 kan yes
We also screened the parts purified by Fabio and Gire : K1,K2,K3 = BBa_J45319 A1,A2=BBa_J45004

12

We took the three inocula of SAMsynthetase+pSB1C3 and we performed the purification (Wizard Plus SV Miniprep DNA purification system). Then to verify if the colonies that we took contain the correct insert we perform the screening protocol and the gel eletrophoresis.

13

We digested using XbaI and PstI and purified the products previously obtained via PCR and via extraction from the registry (pSB1C3 with RFP). We then quantified them at the nano-drop.

Quantification results
pSB1C3 + RfP 27,8 ng/ul
pSB1C3 linearized 17,7 ng/ul
SAM Synthetase 13,2 ng/ul

14

Due to a too high concentration of Cloramphenicol in the plates, we have to re-transform the promoters previously extracted from the registry. We transformed and plated the following parts:

- K323002

- K143012

- K323000

- K323003

Results: since we didn't obtain any colonies we failed the experiment.

15

Inoculum of three B.subtilis backbone
We have done the inoculum of three Bacillus-specific backbone (previously transformed in NEB and plated on Ampicillin LB Agar) in 19 50ml Falcon - 7 with the part BBa_K823023 - 6 with the part BBa_K823022 - 6 with the part BBa_K823027 The Falcons were put in the incubator at 37 °C o/n.
Digestion of SAMsynthetase and psB1C3
We have digested the SAMsynthetase gene (previously amplificated and purificated)and the linerarized vector psB1C3 with the enzyme Xba1 and Pst1 exploiting the same protocol. Then we have incubated the mix at 37C o/n.

16

We purified with the Quick Reference purification kit(GE) and made a PCR of the linearized plasmid pSB1C3 using the prefix and suffix primers and the Phusion polimerase following its protocol. Then we took the PCR samples and checked the results with an electrophoresis gel using the ladder Generuler 1 kb Plus DNA Ladder of Fermentas: As we can see the plasmid, stopped at 2 kb ca (pSB1C3=2070kb).

17

We have done the miniprep of the three backbone exploiting the Kit from Promega.

N.B.Some sample have shown an unexpected red color. There is the possibilities that some backbones contain the RFP, maybe all.

We have quantified the products with the following results:

BBa_K823023(4 sample):220 ng/μl , 228.9 ng/μl ,246.4 ng/μl , 272.3 ng/μl

BBa_K823022(3 sample): 222.8 ng/μl , 227.5 ng/μl ,284.9 ng/μl

BBa_K823027(2 sample):268 ng/μl , 299.3 ng/μl

Then we have tried to verify the parts digesting with EcoR1 and Pst1 and doing an electrophoresis, unfortunately it seems that we didn't load the marker Fermentas 1 KB.

18

We have verifyed the parts from LMU Munich doing an electrophoresis after having digested the parts with Pst1 and EcoR1.
Gel Results
Well Loaded samples
1 DNA Ladder 1Kb
2 #1BBa_J823022(A)
3 #2BBa_J823023(A)
4 #4BBa_J823027(A)
5 #5BBa_J823022(B)
6 #6BBa_J823023(B)
7 #7Bba_J823027(B)

19

Ligation of SAMsynthetase and pSB1C3 with and without RFP, so I prepared four samples:
1) pSB1C3 with RFP (Ctrl_1)
2) pSB1C3 with RFP + SAMsynthetase (1:2)
3) pSB1C3 without RFP (Ctrl_2)
4) pSB1C3 without RFP (1:2)
The samples were prepared and ligation was performed following the ligation protocol.

Ligation parameters
  • Plasmid concentration: 27.8ng/µl
  • Plasmid length: 2070bp
  • Insert concentration: 13.2ng/µl
  • Insert length: 1155bp
  • Used plasmid: 250µl
  • Volume of reaction: 35µl
  • Buffer concentration: 10X

Transformation in NEB10β cells was performed following the transformation protocol. Plates in incubator ON at 37°C static, more than 16 hours.

20

I have prepared the stock solution, 10 ml, for the antibiotic resistance, specifically I have prepared a stock for Ampicillin and Chloramphenicol respectively 50 mg/ml and 34 mg/ml. I have prepared starting from the dust.
Particular care to use Distilled water for Ampicillin and Ethanol for Chloramphenicol.

21

We have prepared LB Agar and then added antibiotic. Finally we have plated the preparation in plastes.
We have prepared plate at the concentration of 50 um/ml for ampicillin and 150 ul/ml for chloramphenicol.
Seems that the concentration of Chloramphenicol is 5 times more concentrated than normally used.

22

Since we received the Ethylen Forming Enzyme gene from Genescript company, we proceeded with the extraction and the transformation test. We resuspended the 4 ug of DNA in 40 ul of sterilized water (obtaining a 100 ng/ul stock solution). After that, we transformed 200 ul of NEB10 competent cells with 1ul of EFE DNA. Finally we plated them in two 50 ug/ml Amp LB-Agar Petri dishes.

Results:

As you can see from the image, we obtained many colonies. We then inculated x5 colonies in 5ml LB with Ampicillin.

23

Me and Bruno transformed the parts that LMU Munich sent us in NEB10beta cells line. The following transformation worked:

Bba_K823022 (pSBBS4S)

Bba_K823027 (pSBBS2E)

Bba_K823023 (pSBBS1C)

24

We followed the protocol for the transformation efficiency kit to determine how efficiency are our competent cells. We performed 5 transformations with 5 different concetrations of the part Bba_J04450 in the plasmid pSB1C3.

25

Both the 1:2 ligation plates have number of colonies comparable with their control:
  • SAMsynthetase+RFP (1:2) = too many to count.
  • SAMsynthetase+RFP (ctrl) = too many to count.
  • SAMsynthetase (1:2) = 11 colonies.
  • SAMsynthetase (ctrl) = 12 colonies.


Performed 5 inocula for each of the two 1:2 plates, in 5ml LB with 5µl CM. Tomorrow miniprep, quantification, digestion and gel to control what happened.

26

Got the inocula from yesterday:
  • 4 out of 5 inocula of SAMsynthetase+pSB1C3[no_RFP] were good, one (3) didn't grow.
  • 4 out of 5 inocula of SAMsynthetase+pSB1C3[RFP] were good, one (5R) was red!

Then, we miniprepped the samples (except for the red, 5R, one) using the protocol. We chose to miniprep also the inocula that did not grow (3), just as a control. After miniprep, quantification was performed with nanodrop.
Quantification results
Sample DNA [ng/µl] Sample DNA [ng/µl]
1 173.7 1R 157.0
2 188.2 2R 97.1
3 18.6 3R 148.0
4 178.7 4R 143.7
5 103.3 5R -

After that, we digested an aliquote of 800ng of each DNA sample with EcoRI and PstI using our digestion protocol, putting the digestion mix to incubate for 1.5h at 37°C (static).
Digestion mix
1 2 4 5 1R 2R 3R 4R
Buffer 10X (Nebuffer4) 2µl
EcoRI 1µl
PstI 1µl
BSA 10X 1µl
Template 4.6µl 4.3µl 4.3µl 7.75µl 5.1µl 8.2µl 5.4µl 5.6µl
Water (up to 20µl) 10.4µl 10.7µl 10.7µl 7.25µl 9.9µl 6.8µl 9.6µl 9.4µl
Total volume 20µl
BamHI 1µl

Then we realized that LacI+RFP and SAMsynthetase have the same base length, and that a gel would not be able to discriminate between them. So, we added 1µl of BamHI to each sample, knowing that this enzyme is able to cut SAMsynthetase (in a band of 100bp and one of 1055bp) to identify the presence of SAM.

So, we prepared a 1.5% agarose gel and performed an electrophoresis for 30 minutes at 120V.
Gel Image
Loaded samples
1kb ladder #1 #2 #4 #5 100bp ladder #1R #2R #3R #4R
From the gel is clear that the samples without RFP (1, 2, 4, 5) do not have any insert. The RFP samples (1R, 2R, 3R, 4R) might contain the SAMsynthetase, but the insert might be LacI+RFP.

To determine whether the insert was LacI+RFP or SAMsynthetase we wanted to perform a RBC Taq PCR against SAMsynthetase (SAMsynthetase-Fw and SAMsynthetase-Rv primers), but we set a wrong PCR program... next time verify the PCR program more accurately!!! On Monday we will start again from the PCR... so sad D:

27

The day after transformation I have check the grow of the our cell line and I have find only 4 colony in the more concentrated plate with DNA. This results is probably due to the very low concentration of DNA insert in the cell line (only 50pg of DNA). However, the presence of cell indicates that the efficiency of the cell is sufficient for our experiments.

28

We wanted to do a trasformation but...we don't have the plates. So, at a good pace, we started to make plates with ampicillin and chloramphenicol.

29

I digested the pSB1C3 linearized with EcoR I and Spe I.
Next I perfomed six different ligations:
two controls with: the pSB1C3 linearized and not but without the insert
two with: pSB1C3 linearized or not and BMST1
two with: pSB1C3 linearized or not and PCHA

30

We took 4 inocula of pSB1C3 and we performed the purification (Wizard Plus SV Miniprep DNA purification system). Then we performed a digestion with EcoRI and PstI of this 4 minipreps, SAM (another time because we were not satisfied of the previous results!) and two pSB1C3. After the digestion we did a gel to understand if it was our lucky day. As you can see from the picture, evidently not! In the afternoon we prepared two PCR reactions: one for J45700 (from the miniprep = it’s the complete device!) and one to linearize and to amplify the pSB1C3 vector. Both the reactions failed and we were too disappointed to take a picture of the gel. Finally we made another digestion for J45319, J45119 and Cate’s pSB1C3 with EcoRI and PstI.

31

Today we started anew extracting SAMsynthetase from the genome of E. coli strain MG1655, following the usual protocol (2 samples for Gabriele and 2 for Emil). Then we performed an electrophoresis on a 1% agarose gel.
Gel Result
Loading scheme
G1 G2 1kb ladder E1 E2


Sadly, something went wrong with G2 sample (probably Gabriele forgot to add something to the PCR mix). But the gel is very beautiful!!!

Then G1, E1 and E2 samples were purified using Wizard® SV Gel and PCR Clean-Up System and then quantified using the Nanodrop.
Quantification results
Sample Quantity
G1 80.2ng/µl
E1 65.7ng/µl
E2 60ng/µl
Sadly, the quantities were not so high, but the results was good anyway!

Finally we prepared overnight digestion of SAMsynthetase (G1 and E1, E2 was put at -20°C) and pSB1C3 linearized both with XbaI and PstI-HF, using the digestion protocol. We used Nebuffer4 and the mix were prepared as follows:
Digestion mix
G1 E1 linear pSB1C3
Nebuffer4 10µl 5µl
XbaI 1µl
PstI-HF 1µl
BSA 1µl [from 100X stock] 5µl [from 10X stock]
DNA [3µg] 37.41µl 45.66µl 37.31µl
Water 49.59µl 41.34µl 0.69µl
Total 100µl 50µl
The mix were incubated at 37°C overnight.

32

We took the ligation products (see the post) done by Caterina on Friday and we transformed them in 200 ul of Neb10β competent cells following the protocol. Than we plated them on LB Agar with Cloramphenicol and incubated O/N to see if something will happen.

33

This morning we added 1µl of SAP to the pSB1C3 overnight digestion and 1µl of DpN1 to the SAMsynthetase overnight digestion, then both were incubated at 37°C for 1.5 hours.

During these 1.5 hours, we performed the miniprep (protocol) and quantification of the circular pSB1C3 inocula of yesterday.
Circular pSB1C3 quantification results
Sample Quantity
G1 184.1 ng/µl
G2 187.7 ng/µl
G3 165.7 ng/µl
E1 117.3 ng/µl
E2 105.7 ng/µl
E3 99.0 ng/µl

After the incubation, we purified the digestion mixes using the Wizard® SV Gel and PCR Clean-Up System and then quantified.
Quantification results
Sample Quantity
linear pSB1C3 30.0 ng/µl
SAMsynthetase G1 40.4 ng/µl
SAMsynthetase E1 32.8 ng/µl

SAMsynthetase E1 was stocked at -20°C.

Then, we performed the ligation of pSB1C3 and SAMsynthetase exploiting the usual protocol.
Ligation mix
Ctrl 1:1 1:2 1:4
Buffer 2.5µl 3.0µl
Plasmid 10 µl
Insert 0 4.14µl 8.28µl 16.56µl
Ligase 2µl
Water 10.5µl 6.36µl 2.22µl 0
Total 25µl
We incubated the ligation mixes for 2 hours at room temperature.

Also, we extracted R0010 promoter (Plac) from the registry (2013 distribution kit, plate 3, well 3H). Unfortunately, we also extracted a part from the same plate and well of the 2012 distribution kit (BBa_K115032) because we mistook the kits.

Finally, we transformed NEB10β competent cells with the usual protocol, we used the following quantities of DNA: 10µl of each ligation product except for the 1:4 ligation, of which we used 15µl, and 1µl of the extracted R0010. Then, we plated on CM plates.

34

I began the week doing some minipreps (x5 of EFE and x5 of pSB1C3+RFP) following this protocol.

Quantification results
Sample EFE pSB1C3
1 253,8 ng/ul 161,9 ng/ul
1 243,5 ng/ul 160,9 ng/ul
3 261,4 ng/ul 142,5 ng/ul
4 218,0 ng/ul 168,4 ng/ul
5 299,1 ng/ul sample lost

I then digested the linearized pSB1C3 (500 ng, kindly offered by Caterina), pSB1C3 + RFP (500 ng) and EFE (1000 ng) with EcorI and PstI following the 2A assembly protocol. After that, I proceeded with the ligation and transformation in NEB10B cells.

35

I inoculated the previously transformed EFE in pSB1C3 and AraCpBAD into 5ml of LB containing Chloramphenicol.

36

First, we extracted K090504 and K090501 (gram+ consitutive promoter and gram+ IPTG inducible promoter)from 2012 kit n5. Then we tried to transform 2 ul of them in 100 ul of NEB10B cells. Furthermore we transformed 3 ul of K823000, K823002, K823003, K143012 in 200 ul of NEB10B.

37

with some tips we selected 2 colonies for each promoter and then put them in LB ( 10 ml) for an overnight incubation (under shake). In the meanwhile we received a new e.coli strain ( NEB5a) and made an inoculum overnight.

38

from the previous inoculum ( with NEB10b cells) we could only take K823000 ( duplicate) and K143012 (triplicate). Then we performed the minipreps and quantified the yields: K823000 a = 30.7 ng/ul K823000 b = 34.2 ng/ul K143012a = 26.8 ng/ul K143012b = 30.3 ng/ul K143012c = 29.5 ng/ul As far as NEB5a are concerned, from the inoculum we made our cells competent. In the afternoon we transformed these cells with our promoters.

39

today we performed the screening protocol in order to verify the real presence of the promoters in the miniprep ( K823000a, K143012b) . To do that, we digested 600 ng of both templates with Ecor1-HF and Pst1-HF

40

Starting from the inocula of yesterday, we did minipreps followingthis protocol.
Quantification results
EFE in pSB1C3 ng/ul AraCpBAD ng/ul
1:4 n°1 552,1 1 285,0
1:4 n°2 482,0 2 311,5
1:4 n°3 558,9 3 446,8
1:2 n°1 779,6 4 404,8
1:2 n°2 376,1 5 442,6
1:1 n°1 359,6
1:1 n°2 501,6
As you can see we obtained a set of very high concentrations. We proceded then with the screening test. To do that we digested 900 ng of DNA with EcorI and PstI following this protocol. In the end we prepared the sample for an electrophoresis analysis. As you can see from the image, al the AraCpBAD samples (on the right of the ladder) were confirmed and 4 out of 7 of EFE were confirmed too.. So we have our second Biobrick! EFE in pSB1C3!

41

Today we (GG, ET, BA) tried to linearize pSB1C3 (with poor results), with this protocol, using the circular DNA samples of Tuesday (18-06): Emil 117.3ng/microl, Gabriele 184.1ng/microl.

Then we prepared a gel (1% GellyPhor gel) and checked for the products.
Gel electrophoresis of the products
Loaded samples Result
1kb ladder -
empty -
B1 OK
B2 OK
B3 OK
E1 NO
E2 NO
E3 NO
G1 NO
G2 OK
G3 OK
empty -
1kb ladder -
Unfortunately, some of the PCR reactions did not succeed!

Then we (GG, ET) have proceeded with the inoculation of pSB1C3+SAMsynthetase (1:1, 1:2, 1:4) and of part R0010 (pLac). Unfortunately there were a few colonies also in the control.
The inocula were performed in plastic culture tubes (15ml) instead of the glass ones, because we do not know how to sterilize the latter. The tubes were filled with 5ml of LB with Cloramphenycol (1µl of 34mg/ml Cloramphenycol stock solution for 1ml of LB).

In the afternoon Gabriele performed again the same PCR protocol to linearize pSB1C3. He loaded the E1-3 samples again, as double-check.
Gel electrophoresis of the products (Gabriele)
Loaded samples Result
G1A NO
G2A OK
G3A OK
G4A OK
1kb ladder -
E1 NO
E2 NO
E3 NO

42

We started digesting 500 ng of AraCpBAD in pSB1C3 with the SpeI and PstI and 500 ng of EFE in Puc57 with XbaI and PstI following digestion for Biobricks protocol.

For the digested vector (AraCpBAD), we incubated the part for one hour at 37°C with the SAP phosphatase before disactivating the enzymes.

We then preceeded by ligating and transforming the two parts in competent NEB10b cells following the ligation protocol for Biobricks .
We decided to do that in duplicate and with different ratios plasmid:insert (ctrl, 1:1, 1:2, 1:4) obtaining so 8 reactions.
Results: as you can see from the pictures, we there are only few colonies in the control so we hope our construct is correctly cloned. The next step will be the inocula and the screening test.

43

I inoculated the previously transformed AraCpBAD + EFE in pSB1C3 into 5ml of LB containing Chloramphenicol.

As you can see, it seems that all the inocula grown. I will proceed with the purification and the screening test!

44

Starting from the inocula of yesterday, I did minipreps following this protocol.
Quantification results
Sample ng/ul
1:1 Plate1 n°1 1201,5
1:1 Plate1 n°2 1620,5
1:2 Plate1 n°1 969,8
1:4 Plate1 n°1 636,3
1:1 Plate2 n°1 672,8
1:1 Plate2 n°2 1222,5
1:2 Plate2 n°1 782,0
1:4 Plate2 n°1 705,3
As you can see we obtained a set of very high concentrations. We proceded then with the screening test. To do that we digested 800 ng of DNA with EcorI and PstI following the screening digestion protocol. In the end we prepared the sample for an electrophoresis analysis.
As you can see, 6 samples out of 8 have the expected bands: 2070bp for the vector and 2300bp for AraCpBAD.

45

I made competent cells from the stock of NEB10beta. I followed the protocol

46

From inocula of the day before I made the minipreps by the following protocol.
Quantification results
Sample ng/ul
K090501 117,1
K090504_a 115,3
K090504_b 101,3
K823000_a 156,0
K823000_b 171,1
K823000 115,5
I made the screening test. To do that we digested 1500 ng of DNA with EcorI and PstI following the screening digestion protocol.
I used a 1.5% concentration of agarose to create a gel and I used Ethidium bromide instead the normal EuroSafe. In addition I have not used a normal Dye with the 20ul of sample loaded but I used 4ul of 30% glycerol.

49

After the incula that Michele made on Sunday of araCpBAD with BBa_K1065100 (BMST1 in pSB1C3) we did the screening of the minipreps. Before obtaining a good result we tried three different gels. As you can see from these pictures (METTI IMMAGINI) the first two gels made from the same digestion were not lucky while the last, performed with different agarose concentration (1.5% instead of 1%) gave a nice result!

50

We quantified yesterday inocula (1:1, 1:2, 1:4 of SAMsynthetase and R0010, both in pSB1C3).
Quantification results
Sample Quantification (ng/µl)
1:1 A 293.0
1:1 B 135.7
1:1 C 178.0
1:1 D 139.3
1:1 E 262.0
1:1 F 147.5
1:1 G 212.5
1:1 H 210.2
1:2 A 141.0
1:2 B 123.6
1:4 A 207.8
1:4 B 127.2
R0010 A 131.7
R0010 B 119.6
R0010 C 371.0
R0010 D 307.9
R0010 E 313.8
Then, we screened the products of ligation (1:1, 1:2, 1:4 and R0010): digestion with EcoRI-HF and PstI-HF following the digestion protocol and agarose gel 1%.
1% Agarose Gel Image
Loading Scheme
Empty
1kb ladder
Empty
1:1 D
1:1 E
Empty
1:2 B
Empty
1:4 A
Empty
R0010 E

1% Agarose Gel Image
Loading scheme
1kb ladder
R0010 A
R0010 B
R0010 C
R0010 D
R0010 E

1% Agarose Gel Image
Loading scheme
R0010 B
R0010 C
R0010 D
1kb ladder
1:4 A
1:4 B
1:2 A
1:2 B

1.5% Agarose Gel Image
Loading scheme
1kb ladder
R0010 A
R0010 B
R0010 C
R0010 D
R0010 E
In these images we can only see the band of the backbone and no insert!

51

Of the 8 inocula (pSB1C3+SAMsynthetase), only 7 succeeded and were purified with the Promega kit, following the miniprep protocol with vacuum. The quantification of the samples (one (D) showed a very strange absorbtion pattern, maybe due to contamination, so here is not presented) gave the following results:
Quantification results
Sample Quantities
A 198 ng/µl
B 187.6 ng/µl
C 138 ng/µl
E 179.9 ng/µl
F 200.2 ng/µl
G 197.2 ng/µl

After that, I have digested 800ng of each sample with EcoR1-HF and Pst1-HF and one (F) also with Xba1 and Pst1-HF following the digestion protocol after 30min at 37°C I have run the final pruduct on a gel with no results again:

I have re-re-tried to linearize pSB1C3 (in triplicates) with no results (in the second line we can see some aspecific bands): Exploiting the iGem 2012 kit I have transformed 2µl of the pLac promoter (R0010 in pSB1A2) in NEB10β competent cells following the transformation protocol. Afterwards, I plated them on an ampicillin-containing plate.

52

We performed 5 inocula from the plate containing the colonies resulted from the transformation of R0010 (in pSB1A2).
The LB medium contained Ampicillin (1:1000).

53

I purified, and then quantified, 3 out of 5 of the previous inocula following the miniprep protocol with vacuum.
Quantification results
Sample Quantity
1 396.1ng/µl
2 523.1ng/µl
3 171ng/µl
Afterwards, I digested 800ng of each sample with Spe1-HF and Pst1-HF following the digestion protocol for screening. Finally I ran the products on a gel (1,5% agarose, due to the short length of the insert: only 200 bp + prefix and suffix). I loaded 12 µl of a ladder 100bp prepared as follows:
Ladder
Quantity
Water 4µl
Sharpmass Euroclone 100bp ladder 1µl
glicerol solution(30%) 1µl
This time, I loaded 12 µl (10 µl of sample and 2 µl of glicerol solution 30%) of each sample.
Gel order
Sample Well
2 µl loading dye 1
Ladder 2
sample 1 3
sample 2 4
sample 3 5
sample 4(Bruno e Fabio) 6
sample 4(Bruno e Fabio) 6
Ladder 1000 kb 7
loading dye 8

We can see 2 bands: the highest is the backbone (pSB1A2: 2079bp) and the lower is pLac (nearly 243bp, located between the bands 300 and 200bp of the ladder).
After the screening I digested 3µg of the pSB1A2+R0010 (sample #2) with SpeI and PstI-HF o/n following the usual protocol.

54

We performed the digestion and the ligation on:

1a)BBa_K1065101 with EcoR I and Xba I and 1b)BBa_J45320 with EcoR I and Spt I

to obtain the complete device BBa_K1065102(placI+PchBA+araC-pBAD promoter+BMST1 in pSB1C3)

2a)pSB1C3 linearized with EcoR I and Pst I 2b)BBa_J45320 with EcoR I and Pst I

to obtain the device BBa_K1065103 (placI+PchBA in pSB1C3).

At the end of the day we did the trasformaion in NEB10β cells. Waiting for the results...break a leg!

55

Today we added 1 µl of SAP to the o/n digestion and then incubated it for 1.5h. Then we performed the ligation of SAMynthetase (previously digested with XbaI and PstI), following the ligation protocol. Afterwards, Gabriele purified the product following the usual purification protocol and then transformed it in NEB10β cells following the transformation protocol.
Gabriele prepared also 4 inocula from the pSB1C3+R0010 CM-plate, just to be sure that it is (not) there.

56

I have re-tried to linearize through a PCR the backbone PsB1C3 that we have previously purified and quntified.
I have tried to amplify the sample of 117.3 ng/µl, 105.7 ng/µl and one of Girelli's sample(184.1 ng/µl)following the Phusion PCR protocol and the universal primers.
No one of this PCRs has succeded!

57

Emil transformed two construct of the ancient Igem competition: both consist in a RBS with the GFP(E0040) and 2 terminators(B0010)(B0012) and are contained in bSB1A2
GFP
ID Quantification RBS strength
BBa_E0240 108.5 ng/µl medium
BBa_E0840 129 ng/µl strong
Emil followed the transformation protocol loading 150 ng of each sample. Then Emil plated the product on an Ampicillin plate.
Moreover Emil did the inocula (in LB + Ampicillin) of two backbones(BBa_823024 and BBa_823026) from the plates of Fabio and Bruno(2 inocula for each sample).

58

In order to evalutate if the expression of EFE is toxic or not to our cells I created a growth curve. I started from an inoculum of AraCpBAD + EFE that I prepared yesterday. I diluited 50ul of the overnight culture in 5ml of LB and I incubated at 37C with shaker until the cultures reached approximately 0,6 O.D at 600nm. I took 2 samples for negative controls and 2 samples for the induced cells. After that I added 25ul of Arabinose 1M stock solution to the induced samples (5mM working solution) and I registered the O.D. of the samples one time per hour (for 4 hours). In the end I plotted the results.


As expected, the strong induction of our gene slightly influences on growth-rate (caused by stress) but still is not completely toxic.
To confirm this result I made a toxicity test by serial dilution. I diluited 50ul of overnight culture (one induced sample and one not induced) into 9,5ml of LB. After vortexed the samples, I further diluited them 1:10 for three times. In the end I plated 150ul of each dilution onto Chloramhenicol Plates.
As you can see from the images, there's not big differences in the colony forming ability of the induced and the not induced sample, even in a dilution of 1:1000. Maybe I should dilute them more!

59

The results of the transformations were not so good. We've only few colonies on each plate (only on Michele's control there were many colonies!). Despite this, we've decided to do inocula of some colonies in the afternoon. On the rest of the day Michele tried two different PCRs to obtain pSB1C3 linearized (someone stole his supplies!!). Obviously no results (immagini gel?). Caterina repeated the digstion but she used two differents type of ligase for the reaction of ligation. At the end of the day she transformed Nebα with these new products of ligation.

60

In orde to caracterize the inducible promoters of the two B. subtilis backbone I have to amplify two reporters and ligate them into the backbones. So I did the miniprep of the 4 inocula(B.subtilis backbones) following the vacuum protocol then I have quantified the products with the following results:
Quantification
Sample Quantification
BBa_K823024 334.4ng/µl
BBa_K823024 260.6ng/µl
BBa_K823026 306.7ng/µl
BBa_K823026 359.7ng/µl
Moreover I did the inocula of the 2 GFPs(BBa_E0240 and BBa_E0840)(4 inocula for each sample) from the plates previously done.

61

I did the miniprep of the 8 inocula(2 GFP constructs) following the vacuum protocol then I have quantified the products with the following results:
Quantification
Sample Quantification
BBa_E0840/1 484.6ng/µl
BBa_E0840/2 376ng/µl
BBa_E0840/3 481.8ng/µl
BBa_E0840/4 475ng/µl
BBa_E0240/1 361ng/µl
BBa_E0240/2 454.4ng/µl
BBa_E0240/3 368ng/µl
BBa_E0240/4 365.8ng/µl
Then I did the screening of the samples E0840/1,E0840/3,E0240/2,E0240/4. I digested 800 ng of each sample with EcoR1-HF and Pst1-HF following the digestion protocol for screening. After 40 minutes I loaded the samples on a gel with the following results:
Gel order
Sample Well
Ladder 1kb Fermentas 1
BBa_E0840/1 2
BBa_E0840/3 3
BBa_E0240/2 4
BBa_E0240/4 5
We can see 2 bands for well: the upper is the backbone(pSB1A2 2079 bp), the lower is presumably the GFP(BBa_E0240 826 bp,BBa_E0840 828 bp)(pefix and suffix escluded ?).

62

First of all Gabriele quantified the four pSB1C3+R0010 inocula of yesterday.
Quantification
Sample Quantity (ng/µl)
#A 243.7
#B 194.1
#C 245.3
#D 252.9

Then, the four quantified samples were screened after a digestion with ExoRI-HF and PstI-HF, with the usual screening protocol (incubated only for 45min, since both the enzymes are HF).

The digestion products were then run on a gel with a transparent loading dye (30% glycerol): each loaded sample contained 16µl of the sample and 4µl of transparent loading dye. Both a 1kb normal ladder and a 100bp transparent ladder were loaded, also the first well was loaded with the usual loading dye.
Gel
Loading scheme
Loading dye
Empty
100bp ladder
#A
#B
#C
#D
Empty
Empty
1kb ladder


Finally, Emil prepared the inocula of the product of ligation of R0010 and SAMsynthetase (in pSB1A2: 6 inocula of the 1:1 ligation product and 3 of the 1:3 ligation producta).

63

I screened the three other sample of GFP(0840/2,0840/4,0240/1,0240/3) like in the previous post with the following results:(the gel was run together with Girelli's sample, we are interested in the first 4 sample)
Gel order
Sample Well
BBa_E0840/2 2
BBa_E0840/4 3
BBa_E0240/1 4
BBa_E0240/3 5
Ladder 1kb Fermentas 1
We can see 2 bands for each sample: the upper is the plasmid(pSB1A2 2079 bp), the lower is presumably the GFP(BBa_E0240 826 bp,BBa_E0840 828 bp)(prefix and suffix escluded)at 900 bp.Afterwards i have amplified 0.5 6micro;l of one of the 4 sample(E0840/4 475.9 ng/micro;l) following the PCR protocol and exploiting the universal primers(prefix Forward,Suffix Reverse) with the following resuts(as usual I did a gel to verify the pcr):
Gel order
Sample Well
BBa_E0840/4 a 2
BBa_E0840/4 b 3
BBa_E0840/4 c 4
Ladder 1kb Fermentas 1
As we can see the pcr completed succesfully, there are the right bands at 900-1000 bp.Then I purified the pcr following the purification protocol . After that I have quantified the product with the following results:
Quantification
Sample Quantification
BBa_E0840/4 a 30.5ng/µl
BBa_E0840/4 b 44ng/µl
BBa_E0840/4 c 42.6ng/µl
Finally I have digested o/n all the 48.5 µl of b sample and of 2 sample of the backbone(K823026 359.7ng/µl,K823024 334.4ng/µl) with EcoR1-HF and Pst1 following the digestion protocol.

64

This morning I added 1 µl of DPN1 to the GFP ligation and 1 µl of SAP(alkaline phosphatase) to the 2 backbones.After 1h 30 min I have stopped the reaction by putting the reaction tubes at 80 C°.Afterwards I have purified the products following the purification protocol.Then I quantified the products with the following results:
Quantification
Sample Quantification
BBa_E0840 15.8ng/µl
BBa_K823026 37.6ng/µl
BBa_K823024 36.4ng/µl

Then I performed the ligation(1:1,1:3,CTRL) of the GFP with the 2 backbone individually and following the ligation protocol.Finally I transformed 10 µl of the ligation protocol in Neb10β and plate them on ampicillin LB agar following the transformation protocol.

65

I miniprepped K823025 and obtained two good yields: 293,5 ng/ul and 236,6 ng/ul; I screened both samples (1000 ng digested in 50 ul) and the gel confirmed the presence of the plasmid. We have another one!! Afterwards we reported a summary table of part obtained and their yelds
Summary table
Sample ng/ul
K823001 a 436.8
b 275.4
c 466.5
K823002a 138.0
b 134.4
c 139.7
K823003 a 85.4
b 99.9
c 118.9
K143012 a 178.3
b 89.2
c 121.4
K823024 a 362.1
d 209.3
e 288.2
K823026 a 246.3
b 315.8
c 550.3

66

OOPS… I DID IT AGAIN!!! Yesterday’s screening was a total failure, so today we tried to screen K823000a and k143012b but unfortunately we chocked again, twice!! We made 2 different gels, with 2 different formulas (the first one with 1 % of agarose, the second one with 1,5 % and 100bp ladder, right for short parts). At the same time we failed to screen a bunch of new promoters miniprepped this morning from some overnight inocula: K823003, k823002, k143012 (all transformed in NEB5a) While attempting to screen those parts we transformed and plated NEB5a with k823000; K050901; K050904 and two new backbones for B.subtilis: K823024 (Pxil) and K823026 (Pspac).

67

The last battle!!! Today we screened successfully three parts, K823003, K823002, K143012 . We used a brand new formula: first of all we digested 1500 ng of DNA in 50 ul. Then we changed the gel composition (1,5 % agarose, 3,5 ul of etidium bromide in 35 ml of gel). Finally we loaded the 100 bp marker along with the 1000kb marker and the parts with a loading dye missing of the dye ( 30% glicerole solution instead). We put this unusual gel in the electrophoresis chamber for 20 minutes. We obtained dim but still present traces. In the afternoon we extracted a new Bacillus promoter (PliaI, K823001) from 2013 registry kit (plate 1 20c) and transformed both in 100 ul of NEB10b and NEB5a. We also did the inocula for the parts plated yesterday.

68

we realized that the other day we put the wrong antibiotic in the new plasmids inocula; according to that Bruno found out that nothing grew in there. So this afternoon we made inocula again, this time with Ampicilline. We also made some inocula of the 3 confermed promoters just to have enough stock material.

69

today we miniprepped k823001, k823024 and k823026 and screened successfully (1500 ng digested for the promoter, 800 ng for the plasmids). WOOT!! we used a standard gel composition for the backbones and the “ brand new formula” for K823001. Thing is, the 2 plasmids seem to be inverted!!! Now we gotta figure out when the two of them have been inverted!!

70

in order to verify weather the plasmids have been inverted during miniprep purification protocol, or screening protocol or even before, during plating, we made the minipreps out of the remaining inocula and then screened them: the risults were the same, so probably we made a mistake during plating! Now everything is more clear!! In the afternoon we made the inoculum of the last plasmid ( K823025, sent right from the Part’s Registry Headquarters).

65

in order to propagate B. subtilis from the pellet that we purchased (strain ind- tyr+ B.subtilis ATCC 23857) , first we needed to obtain the perfect medium for its growth. We prepared Nutrient Broth for liquid cultures and Nutrient Broth + Agar for plates, following ATCC PROTOCOLS. So we decided to have them in both a STARCH-added version and a version without starch.
Nutrient agar (100 ml) : 0,8 g nutrient broth: 1,5g Agar; water to 100 ml.
Nutrient agar + starch (100 ml) : 0,8 g nutrient broth: 1,5g Agar; 2ml starch from potato, water up to 100 ml.
Nutrient broth (250 ml): 2 g nutrient broth; 250 ml water.
Nutrient broth + starch (250 ml): 2 g nutrient broth; 5 ml starch; water up to 250 ml;
To propagate di original bacillus pellet, we resuspended it in 1 ml of nutrient broth+starch and put this milliliter in 5 ml of nutrient broth+starch for a final 6 ml mother liquid culture. Then we made several other liquid cultures with different bacteria concentrations from the Mother (for each concentration we made both starch and non-starch liquid cultures). We put all in a shaker at 26 degrees. We plated also the same concentrations in several plates with both Nutrient agar + starch and Nutrient agar alone, and put them at 26. Just out of curiosity we decided to put some plates and some liquid cultures at 37 degrees.

71

HORROR!! We lost kind of the whole bacillus that we had, during the night, cause the liquid cultures were disrupted in the shaker at 26!! Luckily we have a survivor, the liquid culture at 37, and all the plates.
From the survivor we made further liquid cultures ( at 26°, 1:50 and 1:100; at 37° 1:50 and 1:100)
As soon as they became very cloudy we went along with the glycerol stock preparation and put our bacillus at -80°. The one that weren’t cloudy have been kept in the shaker all night long.
In the afternoon we inoculated some colonies from the plates in 5 ml of nutrient broth +starch.

72

today we made glycerol stock tubes from the remaining cultures and from the inocula made yesterday, but before that we collected some bacteria to make other two liquid cultures just to have more glycerol stock tubes to put at -80°

73

In order to see if our EFE enzyme is effectively active and functional I made a gas-cromatography analysis.
Starting from an overnight culture, I diluted it 1:100 and I incubated it until it reached 0,5 O.D.600. After that, I added 5mM of Arabinose and I incubated the culture at 37°C for about 4-5 hours. In the I connected the vial previously keeped ermetically closed at the micro GC and I took the measure. I did this work for three samples: negative control (not induced), 5mM Arabinose V=1,5ml and 5mM Arabinose V=3ml.
Results table
Sample Ethylene detected
Not induced 0±15 ppm
5mM Arabinose V=1,5ml 30±15 ppm
5mM Arabinose V=3ml 70±15 ppm
As you can see, seems that the device is correct and functionally active! Definetely a good result!

74

Today was a nice day! Finally Michele’s plate were positive (no colonies on the control and lot of them on the others!) So at the end of the day we could do the inocula. Moreover Michele finished the reaction of ligation with the plasmid pSB1C3 linearized (digested the day previous by Caterina (link post)) and J45319 and transformed it in 200 ul of NebB10. At the end of the day Caterina plate them. Everything is working. Hoping that Mesa will be detectable!

75

You know, after a BBBQ, everything is more difficult!! In particular today was an exausting day. While in the morning Caterina did three miniprep from the inocula (post del giorno prima metti link = 4 with araCpBAD + BSTM1 in pSB1C3 and 1 only control of Neb10&beta, mettere immagine del gel di cate) Michele took the two inocula that left and did 7 diluition 1:100 in 20 mL of LB. In particular he did 2 diluition for the control and five for the bacteria with the plasmid. He put them at 37°C in agitation waiting for them reaching O.D. = 0.5. After four hours he did the induction with arabinosio even if the bacteria with the plasmid were at about 0.3 O.D. The induction was done only on five samples to have another control. After two hours it was added different concentrations of Salycilic Acid (in solution with H20 and etanol) in different samples and after two more hours we did a SNIFF Test to understand if some Mesa was produced. The results were not so brilliant: in fact the bacteria in which were added higher concentrations of SA stinked a bit less and were more fresh. Durante la giornata cate ha fatto anche pcr per J45119 ma fail (immagine) In più fatte prime misure con GC per vedere detabilità mesa (grafici)

76

I observed the plates but unfortunately there were some colonies also in the control (perhaps it was due to degradation of ampicillin when it was added to LB agar too hot) so I have decided to re-transform the products of ligation left following the transformation protocol. These are the results of the plate: Moreover I did the inocula of the old plate(3 for K823026+E0840 1:1,3 for K823026+E0840 1:3,3 for K823024+E0840 1:1,3 for K823024+E0840 1:3) in 5 mL of LB with Ampicillin(1:1000).

77

I purified the inocula done the day before following the purification protocol.Then I quantified the results with the following results:
Quantification
Sample Quantification
K823026+E0840 1:3 A 409.4ng/µl
K823026+E0840 1:3 B 401.0ng/µl
K823026+E0840 1:1 C 733.4ng/µl
K823026+E0840 1:1 D 489.3ng/µl
K823024+E0840 1:1 E(succesful) 281ng/µl
K823024+E0840 1:3 F 341.1ng/µl
K823024+E0840 1:3 G 220.3ng/µl
K823024+E0840 1:1 error 129.3ng/µl
Then I screened the purified products following the digestion protocol.These are the results of the gel(1%):
Gel order
Sample Well
Ladder 1kb Fermentas 1
BBa_K823026+BBa_E0840 A 2
BBa_K823026+BBa_E0840 B 3
BBa_K823026+BBa_E0840 C 4
BBa_K823026+BBa_E0840 D 5
BBa_K823024+BBa_E0840 E(the only succesful) 6
BBa_K823024+BBa_E0840 F 7
BBa_K823024+BBa_E0840 G 9
As we can see ther are two bands for each well(like expected after the digestion) but only the lower band of the 6 well has the GFP(920 bp) as insert, the other have only the RFP witha promoter.So I decided to repeat the digestion of GFP(an old sample 42.6 ng/µl digested completely) and the same sample of the two backbone exactly like in the previous days.I did the inocula of the new transformation and also of two colonies of the plate that I tooK the E sample from(2 E sample(1:1 024+0840),1 1:1 024+0840,2 1:3 024+0840,2 1:1 026+0840, 2 1:3 026+0840).

78

I added 1 µl of DPN1 to the insert and 1 µl of SAP to the backbones.Then I have purified the inocula following the miniprep protocol.Afterwards I quantified them toghether with the results of the purification of the digestion products(performed following the purification protocol ) with the following results:
Quantification
Sample Quantification
1:1 024+0840 E 482.6ng/µl
1:1 024+0840 E 700ng/µl
1:1 024+0840 373.1ng/µl
1:3 024+0840 423.5ng/µl
1:3 024+0840 327.8ng/µl
1:1 026+0840 293.1ng/µl
1:1 026+0840 1243ng/µl
1:3 026+0840 766.4ng/µl
1:3 026+0840 369.1ng/µl
GFP 15.9ng/µl
K823026 36.3ng/µl
K823026 43.7ng/µl
Then I digested 800 ng of each sample with EcoR1 HF and Pst1 following the digestion protocol with the following results:
Gel order
Sample Well
Ladder 1kb Fermentas 1
BBa_K823024+BBa_E0840 A 3
BBa_K823024+BBa_E0840 B 5
BBa_K823024+BBa_E0840 C 6
BBa_K823024+BBa_E0840 D 7
BBa_K823024+BBa_E0840 E 8
BBa_K823026+BBa_E0840 F 9
BBa_K823026+BBa_E0840 G 10
BBa_K823026+BBa_E0840 H 11
BBa_K823026+BBa_E0840 I 12
As we can see no one of the wells shows the right insert in the lower band(there is always the previous insert the RFP + Lac promoter ~ 1200 bp).At the same time I did the ligation of K823024+E0840 and K823026+E0840 previously digested following the ligation protocol .
N.B. Remember always to spin the ligation buffer before using
After that I plated the product of the ligation as done before(1:1,1:3,ctrl for each sample) on Ampicillin added LB.