Team:UNITN-Trento/Notebook

First day as iGEMMers at CIBIO (Center for the Integrative Biology)!
We extracted BBa_J45319, BBa_J45320, BBa_J45004 and BBa_J45119 and then transformed them into NEB10β cells.

We performed the purification of BBa_J45320, BBa_J45119, BBa_J45700 (obtained from NEB10β colonies transformed by Viola, Emil and Pedro last week) following the “Wizard® Plus SV Minipreps DNA purification System” protocol. After the quantification through NanoDrop, we digested the plasmid with EcoR I and Pst I to obtain the devices. To verify the correct results of our purification we did an electrophoresis run.

Since we didn't obtained our product using the Phusion PCR, we tried again to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited the same primers used in our previous attempt (see 06-06-2013).

For the protocol used see the RBC Taq PCR protocol.. When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).

Results:

As you can see from our gel image, our product is present in both reactions (TAQ and TAQ+Phusion). After purifying our products we find out that the concentration of DNA that we obtained is too low (about 5ng/ul) maybe for an experimental error in setting the PCR program. For this reason, our team is going to redo the PCR reaction again.

We tried to amplify the SAMsynthase gene from an extract of E.coli genomic DNA (strain MG1655). In order to do that we exploited two primers previoursly designed and synthetized.

Foward: GCCGCTTCTAGAGAAGGAGGAACTACTATGGCAAAACACCTTTTT Reverse: CTGCAGCGGCCGCTACTAGTATTATTACTTCAGACCGGCAG

For the protocol used see the Phusion PCR protocol.. When the reaction finished, we tested the presence of the aplificate product througt an electrophoresis analisys (adding 2 µl of LD for 10 µl of DNA).

Results:

As you can see from our gel image, our product is not present. The next move will be to try to amplify using a TAQ polymerase and we hope that this will work!

We've tried another combination to maximize the outputs of the PCR done to amplify the SAMsynthetase synthase gene from an extract of E.coli genomic DNA (strain MG1655). This time we used the RBC Taq DNA Polymerase protocol but with a mix of this polymerase (0.25 ul) and the Phusion polymerase (0.3 ul). We've prepared two identical samples to see who is the better PCR maker! :)

As you can see from the picture we both obtained great results

We purified the products of SAMsynthetase and pSB1C3 PCR performed by Gire and Pedro following the illustra™ GFX™ PCR DNA and Gel Band Purification Kit protocol. After the quantification with NanoDrop, we did the ligation reaction.

We extracted BBa_K143012, BBa_K823000, BBa_K823002 and BBa_K823003 and then transformed them into NEB10β cells.

We purified the PCR (third attempt) products of SAMsynthetase and pSB1C3 linearized vector following the Quick Reference protocol. After that, we quantified them using the nanodrop instrument.

That's definetely not a good result, however we will continue working with them.

To understand if our Neb10β cells and all our reagents for transformation worked well, we transformed 200 ul of cells with 1 ul of pSB1C3 with RFP, previously purificated. As you can see from the picture we've done a nice job!!

We took the ligation products (SAMsynthetase + pSB1C3 in two different rapports 2:1 and 1:!) done by Caterina and Fabio in the morning and we transformed it in NEB10 cells. We've also prepared some inocula from the plates of the devices extract in CiBio (BBa_J45700, BBa_J45320, BBa_J45119)in LB with the correct antibioticum to have a lot of materials to work on.

We prepared some agar plates with tetracyclin (10ug/ml) and some Luria Broth. Then we extracted, transformed in competent cells and plated the following parts :

part	plasmid	plate	colonies
Bba_J45119	pSB1AT3	amp, tet 10µg/ml, tet 50µg/ml	only in amp plate
Bba_J45320	pSB1AT3	amp, tet 10µg/ml, tet 50µg/ml	only in amp and tet 10µg/ml
Bba_J45 700	pSB1AK3	kan	yes

We also screened the parts purified by Fabio and Gire : K1,K2,K3 = BBa_J45319 A1,A2=BBa_J45004

We took the three inocula of SAMsynthetase+pSB1C3 and we performed the purification (Wizard Plus SV Miniprep DNA purification system). Then to verify if the colonies that we took contain the correct insert we perform the screening protocol and the gel eletrophoresis.

We digested using XbaI and PstI and purified the products previously obtained via PCR and via extraction from the registry (pSB1C3 with RFP). We then quantified them at the nano-drop.

Due to a too high concentration of Cloramphenicol in the plates, we have to re-transform the promoters previously extracted from the registry. We transformed and plated the following parts:

- K323002

- K143012

- K323000

- K323003

Results: since we didn't obtain any colonies we failed the experiment.

Inoculum of three B.subtilis backbone

We have done the inoculum of three Bacillus-specific backbone (previously transformed in NEB and plated on Ampicillin LB Agar) in 19 50ml Falcon - 7 with the part BBa_K823023 - 6 with the part BBa_K823022 - 6 with the part BBa_K823027 The Falcons were put in the incubator at 37 °C o/n.

Digestion of SAMsynthetase and psB1C3

We have digested the SAMsynthetase gene (previously amplificated and purificated)and the linerarized vector psB1C3 with the enzyme Xba1 and Pst1 exploiting the same protocol. Then we have incubated the mix at 37C o/n.

We purified with the Quick Reference purification kit(GE) and made a PCR of the linearized plasmid pSB1C3 using the prefix and suffix primers and the Phusion polimerase following its protocol. Then we took the PCR samples and checked the results with an electrophoresis gel using the ladder Generuler 1 kb Plus DNA Ladder of Fermentas: As we can see the plasmid, stopped at 2 kb ca (pSB1C3=2070kb).

We have done the miniprep of the three backbone exploiting the Kit from Promega.

N.B.Some sample have shown an unexpected red color. There is the possibilities that some backbones contain the RFP, maybe all.

We have quantified the products with the following results:

BBa_K823023(4 sample):220 ng/μl , 228.9 ng/μl ,246.4 ng/μl , 272.3 ng/μl

BBa_K823022(3 sample): 222.8 ng/μl , 227.5 ng/μl ,284.9 ng/μl

BBa_K823027(2 sample):268 ng/μl , 299.3 ng/μl

Then we have tried to verify the parts digesting with EcoR1 and Pst1 and doing an electrophoresis, unfortunately it seems that we didn't load the marker Fermentas 1 KB.

Since we received the Ethylen Forming Enzyme gene from Genescript company, we proceeded with the extraction and the transformation test. We resuspended the 4 ug of DNA in 40 ul of sterilized water (obtaining a 100 ng/ul stock solution). After that, we transformed 200 ul of NEB10 competent cells with 1ul of EFE DNA. Finally we plated them in two 50 ug/ml Amp LB-Agar Petri dishes.

Results:

As you can see from the image, we obtained many colonies. We then inculated x5 colonies in 5ml LB with Ampicillin.

Ligation of SAMsynthetase and pSB1C3 with and without RFP, so I prepared four samples:
1) pSB1C3 with RFP (Ctrl_1)
2) pSB1C3 with RFP + SAMsynthetase (1:2)
3) pSB1C3 without RFP (Ctrl_2)
4) pSB1C3 without RFP (1:2)
The samples were prepared and ligation was performed following the ligation protocol.


Transformation in NEB10β cells was performed following the transformation protocol. Plates in incubator ON at 37°C static, more than 16 hours.

I have prepared the stock solution, 10 ml, for the antibiotic resistance, specifically I have prepared a stock for Ampicillin and Chloramphenicol respectively 50 mg/ml and 34 mg/ml. I have prepared starting from the dust.
Particular care to use Distilled water for Ampicillin and Ethanol for Chloramphenicol.

We have prepared LB Agar and then added antibiotic. Finally we have plated the preparation in plastes.
We have prepared plate at the concentration of 50 um/ml for ampicillin and 150 ul/ml for chloramphenicol.
Seems that the concentration of Chloramphenicol is 5 times more concentrated than normally used.

We have verifyed the parts from LMU Munich doing an electrophoresis after having digested the parts with Pst1 and EcoR1.

Me and Bruno transformed the parts that LMU Munich sent us in NEB10beta cells line. The following transformation worked:

Bba_K823022 (pSBBS4S)

Bba_K823027 (pSBBS2E)

Bba_K823023 (pSBBS1C)

We followed the protocol for the transformation efficiency kit to determine how efficiency are our competent cells. We performed 5 transformations with 5 different concetrations of the part Bba_J04450 in the plasmid pSB1C3.

Both the 1:2 ligation plates have number of colonies comparable with their control:

• SAMsynthetase+RFP (1:2) = too many to count.
• SAMsynthetase+RFP (ctrl) = too many to count.
• SAMsynthetase (1:2) = 11 colonies.
• SAMsynthetase (ctrl) = 12 colonies.

Performed 5 inocula for each of the two 1:2 plates, in 5ml LB with 5µl CM. Tomorrow miniprep, quantification, digestion and gel to control what happened.

Got the inocula from yesterday:

• 4 out of 5 inocula of SAMsynthetase+pSB1C3[no_RFP] were good, one (3) didn't grow.
• 4 out of 5 inocula of SAMsynthetase+pSB1C3[RFP] were good, one (5R) was red!

Then, we miniprepped the samples (except for the red, 5R, one) using the protocol. We chose to miniprep also the inocula that did not grow (3), just as a control. After miniprep, quantification was performed with nanodrop.

After that, we digested an aliquote of 800ng of each DNA sample with EcoRI and PstI using our digestion protocol, putting the digestion mix to incubate for 1.5h at 37°C (static).

Then we realized that LacI+RFP and SAMsynthetase have the same base length, and that a gel would not be able to discriminate between them. So, we added 1µl of BamHI to each sample, knowing that this enzyme is able to cut SAMsynthetase (in a band of 100bp and one of 1055bp) to identify the presence of SAM.

So, we prepared a 1.5% agarose gel and performed an electrophoresis for 30 minutes at 120V. From the gel is clear that the samples without RFP (1, 2, 4, 5) do not have any insert. The RFP samples (1R, 2R, 3R, 4R) might contain the SAMsynthetase, but the insert might be LacI+RFP.

To determine whether the insert was LacI+RFP or SAMsynthetase we wanted to perform a RBC Taq PCR against SAMsynthetase (SAMsynthetase-Fw and SAMsynthetase-Rv primers), but we set a wrong PCR program... next time verify the PCR program more accurately!!! On Monday we will start again from the PCR... so sad D:

The day after transformation I have check the grow of the our cell line and I have find only 4 colony in the more concentrated plate with DNA. This results is probably due to the very low concentration of DNA insert in the cell line (only 50pg of DNA). However, the presence of cell indicates that the efficiency of the cell is sufficient for our experiments.

We wanted to do a trasformation but...we don't have the plates. So, at a good pace, we started to make plates with ampicillin and chloramphenicol.

I digested the pSB1C3 linearized with EcoR I and Spe I.
Next I perfomed six different ligations:
two controls with: the pSB1C3 linearized and not but without the insert
two with: pSB1C3 linearized or not and BMST1
two with: pSB1C3 linearized or not and PCHA

We took 4 inocula of pSB1C3 and we performed the purification (Wizard Plus SV Miniprep DNA purification system). Then we performed a digestion with EcoRI and PstI of this 4 minipreps, SAM (another time because we were not satisfied of the previous results!) and two pSB1C3. After the digestion we did a gel to understand if it was our lucky day. As you can see from the picture, evidently not! In the afternoon we prepared two PCR reactions: one for J45700 (from the miniprep = it’s the complete device!) and one to linearize and to amplify the pSB1C3 vector. Both the reactions failed and we were too disappointed to take a picture of the gel. Finally we made another digestion for J45319, J45119 and Cate’s pSB1C3 with EcoRI and PstI.

Today we started anew extracting SAMsynthetase from the genome of E. coli strain MG1655, following the usual protocol (2 samples for Gabriele and 2 for Emil). Then we performed an electrophoresis on a 1% agarose gel.
Sadly, something went wrong with G2 sample (probably Gabriele forgot to add something to the PCR mix). But the gel is very beautiful!!!

Then G1, E1 and E2 samples were purified using Wizard® SV Gel and PCR Clean-Up System and then quantified using the Nanodrop. Sadly, the quantities were not so high, but the results was good anyway!

Finally we prepared overnight digestion of SAMsynthetase (G1 and E1, E2 was put at -20°C) and pSB1C3 linearized both with XbaI and PstI-HF, using the digestion protocol. We used Nebuffer4 and the mix were prepared as follows: The mix were incubated at 37°C overnight.

We took the ligation products (see the post "Digestion & ligation of BMST1 (BBa_J45119) and PCHA (BBa_J45319))" done by Caterina on Friday and we transformed them in 200 ul of Neb10β competent cells following the protocol. Than we plated them on LB Agar with Cloramphenicol and incubated O/N to see if something will happen.

This morning we added 1µl of SAP to the pSB1C3 overnight digestion and 1µl of DpN1 to the SAMsynthetase overnight digestion, then both were incubated at 37°C for 1.5 hours.

During these 1.5 hours, we performed the miniprep (protocol) and quantification of the circular pSB1C3 inocula of yesterday.

After the incubation, we purified the digestion mixes using the Wizard® SV Gel and PCR Clean-Up System and then quantified.
Then, we performed the ligation of pSB1C3 and SAMsynthetase exploiting the usual protocol. We incubated the ligation mixes for 2 hours at room temperature.

Also, we extracted R0010 promoter (Plac) from the registry (2013 distribution kit, plate 3, well 3H). Unfortunately, we also extracted a part from the same plate and well of the 2012 distribution kit (BBa_K115032) because we mistook the kits.

Finally, we transformed NEB10β competent cells with the usual protocol, we used the following quantities of DNA: 10µl of each ligation product except for the 1:4 ligation, of which we used 15µl, and 1µl of the extracted R0010. Then, we plated on CM plates.

I began the week doing some minipreps (x5 of EFE and x5 of pSB1C3+RFP) following this protocol.

I then digested the linearized pSB1C3 (500 ng, kindly offered by Caterina), pSB1C3 + RFP (500 ng) and EFE (1000 ng) with EcorI and PstI following the 2A assembly protocol. After that, I proceeded with the ligation and transformation in NEB10B cells.

I inoculated the previously transformed EFE in pSB1C3 and AraCpBAD into 5ml of LB containing Chloramphenicol.

First, we extracted K090504 and K090501 (gram+ consitutive promoter and gram+ IPTG inducible promoter)from 2012 kit n5. Then we tried to transform 2 ul of them in 100 ul of NEB10B cells. Furthermore we transformed 3 ul of K823000, K823002, K823003, K143012 in 200 ul of NEB10B.

with some tips we selected 2 colonies for each promoter and then put them in LB ( 10 ml) for an overnight incubation (under shake). In the meanwhile we received a new e.coli strain ( NEB5a) and made an inoculum overnight.

from the previous inoculum ( with NEB10b cells) we could only take K823000 ( duplicate) and K143012 (triplicate). Then we performed the minipreps and quantified the yields: K823000 a = 30.7 ng/ul K823000 b = 34.2 ng/ul K143012a = 26.8 ng/ul K143012b = 30.3 ng/ul K143012c = 29.5 ng/ul As far as NEB5a are concerned, from the inoculum we made our cells competent. In the afternoon we transformed these cells with our promoters.

today we performed the screening protocol in order to verify the real presence of the promoters in the miniprep ( K823000a, K143012b) . To do that, we digested 600 ng of both templates with Ecor1-HF and Pst1-HF

Starting from the inocula of yesterday, we did minipreps followingthis protocol. As you can see we obtained a set of very high concentrations. We proceded then with the screening test. To do that we digested 900 ng of DNA with EcorI and PstI following this protocol. In the end we prepared the sample for an electrophoresis analysis. As you can see from the image, al the AraCpBAD samples (on the right of the ladder) were confirmed and 4 out of 7 of EFE were confirmed too.. So we have our second Biobrick! EFE in pSB1C3!

Today we (GG, ET, BA) tried to linearize pSB1C3 (with poor results), with this protocol, using the circular DNA samples of Tuesday (18-06): Emil 117.3ng/microl, Gabriele 184.1ng/microl.

Then we prepared a gel (1% GellyPhor gel) and checked for the products. Unfortunately, some of the PCR reactions did not succeed!

Then we (GG, ET) have proceeded with the inoculation of pSB1C3+SAMsynthetase (1:1, 1:2, 1:4) and of part R0010 (pLac). Unfortunately there were a few colonies also in the control.
The inocula were performed in plastic culture tubes (15ml) instead of the glass ones, because we do not know how to sterilize the latter. The tubes were filled with 5ml of LB with Cloramphenycol (1µl of 34mg/ml Cloramphenycol stock solution for 1ml of LB).

In the afternoon Gabriele performed again the same PCR protocol to linearize pSB1C3. He loaded the E1-3 samples again, as double-check.

We started digesting 500 ng of AraCpBAD in pSB1C3 with the SpeI and PstI and 500 ng of EFE in Puc57 with XbaI and PstI following digestion for Biobricks protocol.

For the digested vector (AraCpBAD), we incubated the part for one hour at 37°C with the SAP phosphatase before disactivating the enzymes.

We then preceeded by ligating and transforming the two parts in competent NEB10b cells following the ligation protocol for Biobricks .
We decided to do that in duplicate and with different ratios plasmid:insert (ctrl, 1:1, 1:2, 1:4) obtaining so 8 reactions.
Results: as you can see from the pictures, we there are only few colonies in the control so we hope our construct is correctly cloned. The next step will be the inocula and the screening test.

I inoculated the previously transformed AraCpBAD + EFE in pSB1C3 into 5ml of LB containing Chloramphenicol.

As you can see, it seems that all the inocula grown. I will proceed with the purification and the screening test!

Starting from the inocula of yesterday, I did minipreps following this protocol. As you can see we obtained a set of very high concentrations. We proceded then with the screening test. To do that we digested 800 ng of DNA with EcorI and PstI following the screening digestion protocol. In the end we prepared the sample for an electrophoresis analysis.
As you can see, 6 samples out of 8 have the expected bands: 2070bp for the vector and 2300bp for AraCpBAD.

I made competent cells from the stock of NEB10beta. I followed the protocol

From inocula of the day before I made the minipreps by the following protocol. I made the screening test. To do that we digested 1500 ng of DNA with EcorI and PstI following the screening digestion protocol.
I used a 1.5% concentration of agarose to create a gel and I used Ethidium bromide instead the normal EuroSafe. In addition I have not used a normal Dye with the 20ul of sample loaded but I used 4ul of 30% glycerol.